Previous Contig 013122:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037N11Sequence660013122 (2)pir|D84694|D846942e-50probable tropinone reductase [imported] - Arabidopsis thaliana>gb:AC004561_15318754013122 (2)pir|D84694|D846943e-76probable tropinone reductase [imported] - Arabidopsis thaliana>gb:AC004561_15318

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037N11- GGATAGCTCCAAAATTTGTAATTCTTCACCA
                      ____________________________________________________________
consensus GGATAGCTCCAAAATTTGTAATTCTTCACCA
 
. : . : . : . : . : . :
JMSF037N11- CCACCCCCACCGCCGCCCGCCGCCCGCCGCCTCCTCCTATTGCTTTCGGAACAATCAAAG
                      ____________________________________________________________
consensus CCACCCCCACCGCCGCCCGCCGCCCGCCGCCTCCTCCTATTGCTTTCGGAACAATCAAAG
 
. : . : . : . : . : . :
JMSF037N11- TCTCAAACAAGCAGTCTCAGTGGAAGTAGAAGCTAACATCATAAATGTCTCAGACCCTCG
                      ____________________________________________________________
consensus TCTCAAACAAGCAGTCTCAGTGGAAGTAGAAGCTAACATCATAAATGTCTCAGACCCTCG
 
. : . : . : . : . : . :
JMSF037N11- TCGTACGATCTCCCCTAGCGCCTTTACACTCAGCCGCCGCCCCTCACGGCGTCCGACTAT
                      ____________________________________________________________
consensus TCGTACGATCTCCCCTAGCGCCTTTACACTCAGCCGCCGCCCCTCACGGCGTCCGACTAT
 
. : . : . : . : . : . :
JMSF037N11- CAAAACACACTATCACTCGCACACGCAAGTGGACGGTCACCGCACATTCCAGGAAAGGCG
                      ____________________________________________________________
consensus CAAAACACACTATCACTCGCACACGCAAGTGGACGGTCACCGCACATTCCAGGAAAGGCG
 
. : . : . : . : . : . :
JMSF037N11- GCGACCGGTGGTCACTTCACGGCATGAGTGCCCTCGTTACCGGCGGCACCAGAGGCATTG
                      ____________________________________________________________
consensus GCGACCGGTGGTCACTTCACGGCATGAGTGCCCTCGTTACCGGCGGCACCAGAGGCATTG
 
. : . : . : . : . : . :
JMSF037N11- GGAACGCCATTGTGGAGGAATTGGCGGGACTTGGAGCCAGCGTGCATACTTGCGCCCGTA
                      ____________________________________________________________
consensus GGAACGCCATTGTGGAGGAATTGGCGGGACTTGGAGCCAGCGTGCATACTTGCGCCCGTA
 
. : . : . : . : . : . :
JMSF037N11- GCGAAGAGGAGCTGGGAAAATGCTTGAGGGGATGGAAAGAGGAAGGGTTTGAAGTGAGTG
                      ____________________________________________________________
consensus GCGAAGAGGAGCTGGGAAAATGCTTGAGGGGATGGAAAGAGGAAGGGTTTGAAGTGAGTG
 
. : . : . : . : . : . :
JMSF037N11- GATCAGTGTGCGATGTGTCTTCTCGGCCTGATCGCCAGAAGCTAATGGAGGCTGTTTCTT
rJMSF037N11+ CCTGATCGCCAGAAGCTAATGGAGGCTGTTTCTT
                      ____________________________________________________________
consensus GATCAGTGTGCGATGTGTCTTCTCGGCCTGATCGCCAGAAGCTAATGGAGGCTGTTTCTT
 
. : . : . : . : . : . :
JMSF037N11- CTACTTTCAGTGGAAAGCTCGATATCCTTATAAACAATGTTGGGACAAATATACGAAAAC
rJMSF037N11+ CTACTTTCAGTGGAAAGCTCGATATCCTTATAAACAATGTTGGGACAAATATACGAAAAC
                      ____________________________________________________________
consensus CTACTTTCAGTGGAAAGCTCGATATCCTTATAAACAATGTTGGGACAAATATACGAAAAC
 
. : . : . : . : . : . :
JMSF037N11- CTGTATCGGATTTCACAGCCGAGGACTTTACCACCCTATTGGCAACAAACTTCGAATCAG
rJMSF037N11+ CTGTATCGGATTTCACAGCCGAGGACTTTACCACCCTATTGGCAACAAACTTCGAATCAG
                      ____________________________________________________________
consensus CTGTATCGGATTTCACAGCCGAGGACTTTACCACCCTATTGGCAACAAACTTCGAATCAG
 
. : . : . : . : . : . :
JMSF037N11- TTTTTCATCTATGCCAACTTGCCTATCCT
rJMSF037N11+ TTTTTCATCTATGCCAACTTGCCTATCCTCTTCTTAAAGCATCGGGGGCAGGATGTGTTG
                      ____________________________________________________________
consensus TTTTTCATCTATGCCAACTTGCCTATCCTCTTCTTAAAGCATCGGGGGCAGGATGTGTTG
 
. : . : . : . : . : . :
rJMSF037N11+ TATTCACTTCATCTGTCTCGGCTTTTGTATCACTGAAGTCTATGTCTGTCCAAGGAGCAA
                      ____________________________________________________________
consensus TATTCACTTCATCTGTCTCGGCTTTTGTATCACTGAAGTCTATGTCTGTCCAAGGAGCAA
 
. : . : . : . : . : . :
rJMSF037N11+ CGAAAGGAGCTATTAACCAACTTACGAAAAGCTTGGCGTGTGAGTGGGCAAAAGACAATA
                      ____________________________________________________________
consensus CGAAAGGAGCTATTAACCAACTTACGAAAAGCTTGGCGTGTGAGTGGGCAAAAGACAATA
 
. : . : . : . : . : . :
rJMSF037N11+ TCAGGAGCAATGGTGTCGCGCCTTGGTACATCAGAACATCTATGGTGGAGCAAGTGCTGA
                      ____________________________________________________________
consensus TCAGGAGCAATGGTGTCGCGCCTTGGTACATCAGAACATCTATGGTGGAGCAAGTGCTGA
 
. : . : . : . : . : . :
rJMSF037N11+ GTAATGAGGAATATGTAGAGGAGGTTTATGATAGGACTCCTCTAAGACGCCTGGGAGAGC
                      ____________________________________________________________
consensus GTAATGAGGAATATGTAGAGGAGGTTTATGATAGGACTCCTCTAAGACGCCTGGGAGAGC
 
. : . : . : . : . : . :
rJMSF037N11+ CCGAAGAGGTGTCTTCTCTTGTGGCATTCCTCTGTTTACCTGCTTCATCTTACATAACTG
                      ____________________________________________________________
consensus CCGAAGAGGTGTCTTCTCTTGTGGCATTCCTCTGTTTACCTGCTTCATCTTACATAACTG
 
. : . : . : . : . : . :
rJMSF037N11+ GTCAGATCATTTGTGTCGATGGTGGCATGACCGTAAATGGATTTTATCCCCGGCATGGCT
                      ____________________________________________________________
consensus GTCAGATCATTTGTGTCGATGGTGGCATGACCGTAAATGGATTTTATCCCCGGCATGGCT
 
. : . : . : . : . : . :
rJMSF037N11+ AAAACTGCAGAAAACGAACTCTTTCCGCCCAAAGAATCAATGCCTCACCACCAGGTTCGA
                      ____________________________________________________________
consensus AAAACTGCAGAAAACGAACTCTTTCCGCCCAAAGAATCAATGCCTCACCACCAGGTTCGA
 
. : . : . : . : . : . :
rJMSF037N11+ TCCTGTAACCATTTCATAACGGCCACATAGTAATTGGTAAATTCTTTGTTTTCTATTGGA
                      ____________________________________________________________
consensus TCCTGTAACCATTTCATAACGGCCACATAGTAATTGGTAAATTCTTTGTTTTCTATTGGA
 
. : . : . : . : . : . :
rJMSF037N11+ TCTTGTGACCATTCAGTAATAGAAGTGCTATCAGATTTCATAGTAGTTGACAAATTCTTT
                      ____________________________________________________________
consensus TCTTGTGACCATTCAGTAATAGAAGTGCTATCAGATTTCATAGTAGTTGACAAATTCTTT