Previous Contig 013119:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030E18Sequence625007171 (6)gb:AF240679_17800361e-32Cucumis sativus poly(A)-binding protein mRNA, complete cds.711013119 (3)gb:AF190657_17754403e-49Nicotiana tabacum clone 7 poly(A)-binding protein (PABP) mRNA, partial cds.
JMSF036D23Sequence706013119 (3)gb:AF190657_17754402e-80Nicotiana tabacum clone 7 poly(A)-binding protein (PABP) mRNA, partial cds.584002383 (18)sp|Q02764|RK24_TOBAC9e-6750S ribosomal protein L24, chloroplast precursor (CL24).>pir|A45113|A45113 ribos
JMSF037L23Sequence695007171 (6)gb:AF240679_17800367e-44Cucumis sativus poly(A)-binding protein mRNA, complete cds.737013119 (3)gb:AF190657_17754404e-50Nicotiana tabacum clone 7 poly(A)-binding protein (PABP) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036D23+ TGAGGAAGCTTCCAGAGCTCTTAACGAGATGAATGCAAAAATGATAATCAGCA
                      ____________________________________________________________
consensus TGAGGAAGCTTCCAGAGCTCTTAACGAGATGAATGCAAAAATGATAATCAGCA
 
. : . : . : . : . : . :
JMSF036D23+ AGCCACTTTATGTTGCAATTGCTCAGCGGAAAGAAGAGAGAAAGGCAAAGTTGCAGGCGC
                      ____________________________________________________________
consensus AGCCACTTTATGTTGCAATTGCTCAGCGGAAAGAAGAGAGAAAGGCAAAGTTGCAGGCGC
 
. : . : . : . : . : . :
JMSF036D23+ AGTTTTCACAGATGCGACCAGTTGCAGTGACACCAGCTCTCGCTCCTCGAATGCCAATGT
                      ____________________________________________________________
consensus AGTTTTCACAGATGCGACCAGTTGCAGTGACACCAGCTCTCGCTCCTCGAATGCCAATGT
 
. : . : . : . : . : . :
JMSF036D23+ ATCCTCCTGGTGCACCAGGTATTGGCCAGCAGCTCTTTTATGGCCAAGCTCCACCTGCTA
                      ____________________________________________________________
consensus ATCCTCCTGGTGCACCAGGTATTGGCCAGCAGCTCTTTTATGGCCAAGCTCCACCTGCTA
 
. : . : . : . : . : . :
JMSF036D23+ TGATTCCTCACCAGGCCGGATTTGGATACCAGCAACAGCTTGTCCCCGGAATGCGGCCAG
                      ____________________________________________________________
consensus TGATTCCTCACCAGGCCGGATTTGGATACCAGCAACAGCTTGTCCCCGGAATGCGGCCAG
 
. : . : . : . : . : . :
JMSF036D23+ GAGGAGCTCCAATGCCAAATTTTTTTGTGCCACTTGTCCAACAGGGTCAGCAAGGCCAGT
rJMSF030E18+ GTCCAGCAGGGTCAACAAGCCCAAC
                      ____________________________________________________________
consensus GAGGAGCTCCAATGCCAAATTTTTTTGTGCCACTTGTCCAGCAGGGTCAGCAAGGCCAGT
 
. : . : . : . : . : . :
JMSF036D23+ GTCCAGGTGGCAGGCGTGGATCTGGACCAGTGCAACAAGCTCAGCAGACTATGCCCTTGA
rJMSF030E18+ GTCAAGGTGGCAGGCGTGGAGCGGGACCTGGCCAACAAGCTCAGCAGCCTATGCCTTTGA
                      ____________________________________________________________
consensus GTCCAGGTGGCAGGCGTGGATCTGGACCTGTGCAACAAGCTCAGCAGCCTATGCCTTTGA
 
. : . : . : . : . : . :
JMSF036D23+ TGCAACAGCAGATGCTCCCAAGGGGAAGGATGTATCGATTCCCCCCTGGCCGGAATGTGC
rJMSF030E18+ TGCAACAGCAGATGCTTCCAAGGGGTAGGATGTACCGGTTTCCACCTGGCCGCAATGTGC
                      ____________________________________________________________
consensus TGCAACAGCAGATGCTTCCAAGGGGTAGGATGTATCGGTTTCCCCCTGGCCGGAATGTGC
 
. : . : . : . : . : . :
JMSF036D23+ CAGAGGTGCCAGTGCCCGGTGTGGGTGGAGGTCTTCTTTCTGTTCCATATGATATGGGTG
rJMSF030E18+ CAGAGGTTCCTGTGCCTGGTGTGGGTGGAGGTATGCTTTCTGTTCCATATGATATGGGTG
                      ____________________________________________________________
consensus CAGAGGTTCCTGTGCCTGGTGTGGGTGGAGGTCTTCTTTCTGTTCCATATGATATGGGTG
 
. : . : . : . : . : . :
JMSF036D23+ GTGTTGCACTTCCTCGAGA---TGGTTCTTTGGGACAACCTGTACCAATTACCGCACTTG
rJMSF030E18+ GAAT---CCTTCCTCGAGATGCTGCTACTATGGGACAGCCTGTGCCAATTACAGCACTTG
rJMSF037L23+ CCAATTACAGCACTTG
                      ____________________________________________________________
consensus GTGTTGCCCTTCCTCGAGATGCTGGTTCTTTGGGACAGCCTGTGCCAATTACAGCACTTG
 
. : . : . : . : . : . :
JMSF036D23+ CAAGTGCCCTTGCAAATGCACCGCCCGAGCAACAGAGGACAATGCTTGGTGAGAATTTGT
rJMSF030E18+ CTAGTGCCCTTGCTAACGCACCACCCGAACAACAGAGGACTATGTTAGGTGAAAATCTGT
rJMSF037L23+ CTAGTGCCCTTGCTAACGCACCACCCGAACAACAGAGGACTATGTTAGGTGAAAATCTGT
                      ____________________________________________________________
consensus CTAGTGCCCTTGCTAACGCACCACCCGAACAACAGAGGACTATGTTAGGTGAAAATCTGT
 
. : . : . : . : . : . :
JMSF036D23+ ACCCACTTGTTGATCAACTGGAGCACGAGCACGCAGCAAAGGTTACAGGCATGCTT
rJMSF030E18+ ACCCGCTTGTCGATCAGTTGGAGCATGAGCACGCTGCCAAAGTAACTGGCATGCTGCTCG
rJMSF037L23+ ACCCGCTTGTCGATCAGTTGGAGCATGAGCACGCTGCCAAAGTAACTGGCATGCTGCTCG
                      ____________________________________________________________
consensus ACCCGCTTGTCGATCAGTTGGAGCATGAGCACGCTGCCAAAGTAACTGGCATGCTGCTCG
 
. : . : . : . : . : . :
rJMSF030E18+ AGATGGACCAGACGGAGGTTTTGCATCTACTCGAATCACCAGAGGCTTTGAAGTCCAAAG
rJMSF037L23+ AGATGGACCAGACGGAGGTTTTGCATCTACTCGAATCACCAGAGGCTTTGAAGTCCAAAG
                      ____________________________________________________________
consensus AGATGGACCAGACGGAGGTTTTGCATCTACTCGAATCACCAGAGGCTTTGAAGTCCAAAG
 
. : . : . : . : . : . :
rJMSF030E18+ TTGCAGAGGCTATGGATGTTTTGAGAAACGTTCAGCAG
rJMSF037L23+ TTGCAGAGGCTATGGATGTTTTGAGAAACGTTCAGCAGCAGGCAAGCAGCCCTGCTGATC
                      ____________________________________________________________
consensus TTGCAGAGGCTATGGATGTTTTGAGAAACGTTCAGCAGCAGGCAAGCAGCCCTGCTGATC
 
. : . : . : . : . : . :
rJMSF037L23+ AACTCGCCTCTCTTTCCCTCAACGAAAACCTTGTTTCTTGAGTCCAGGCAGGAGGCCAGC
                      ____________________________________________________________
consensus AACTCGCCTCTCTTTCCCTCAACGAAAACCTTGTTTCTTGAGTCCAGGCAGGAGGCCAGC
 
. : . : . : . : . : . :
rJMSF037L23+ GGTCCAAGTCCAAGGATGTCCGATGTTTAGATTATGGCAGGAGGCAGCGGTCCAAGGATG
                      ____________________________________________________________
consensus GGTCCAAGTCCAAGGATGTCCGATGTTTAGATTATGGCAGGAGGCAGCGGTCCAAGGATG
 
. : . : . : . : . : . :
rJMSF037L23+ TCTGATGTTTAGATTATCTTATCGCCTTCCTTCCTTTTTAGTTCAGCTGGTAGTTTATTA
                      ____________________________________________________________
consensus TCTGATGTTTAGATTATCTTATCGCCTTCCTTCCTTTTTAGTTCAGCTGGTAGTTTATTA
 
. : . : . : . : . : . :
rJMSF037L23+ GTAGTTTTGAGTATTATTATGGGATAATATTTCTTAGGTTTTCGAATGAGATTTGATATC
                      ____________________________________________________________
consensus GTAGTTTTGAGTATTATTATGGGATAATATTTCTTAGGTTTTCGAATGAGATTTGATATC
 
. : . : . : . : . : . :
rJMSF037L23+ CTCTATCGCATTAGGTATTTTTTGATTTCATTAATGCTCTTATCTATGACATGAAGAGAG
                      ____________________________________________________________
consensus CTCTATCGCATTAGGTATTTTTTGATTTCATTAATGCTCTTATCTATGACATGAAGAGAG