Previous Contig 013107:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037H13Sequence682013107 (4)gb:AY065095_15662493e-69Arabidopsis thaliana unknown protein mRNA, complete cds.>gb:AY128740_1580820 Ara744013107 (4)gb:AY125545_15803509e-69Arabidopsis thaliana At4g29227 mRNA, complete cds.>gb:AF428378_1799308 Arabidops
JMSF038H13Sequence430013107 (4)gb:AY065095_15662495e-35Arabidopsis thaliana unknown protein mRNA, complete cds.>gb:AY128740_1580820 Ara913013107 (4)gb:AY125545_15803502e-91Arabidopsis thaliana At4g29227 mRNA, complete cds.>gb:AF428378_1799308 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038H13- GAGGAGG
JMSF037H13- GAGGAGG
                      ____________________________________________________________
consensus GAGGAGG
 
. : . : . : . : . : . :
JMSF038H13- ACACTATCACCTATCCGCCACCGCCCTTCCCGGTGGCTCACGGCGGAAGTCATCGGGCTC
JMSF037H13- ACACTATCACCTATCCGCCACCGCCCTTCCCGGTGGCTCACGGCGGAAGTCATCGGGCTC
                      ____________________________________________________________
consensus ACACTATCACCTATCCGCCACCGCCCTTCCCGGTGGCTCACGGCGGAAGTCATCGGGCTC
 
. : . : . : . : . : . :
JMSF038H13- TCCACTGNTCCAGCGTTAACTTCAGTGTCTCTCGTACTAGAGTTTTCAAGTCGGAAATGT
JMSF037H13- TCCACTG-TCCAGCGTTAACTTCAGTGTCTCTCGTACTAGAGTTTTCAAGTCGGAAATGT
                      ____________________________________________________________
consensus TCCACTGNTCCAGCGTTAACTTCAGTGTCTCTCGTACTAGAGTTTTCAAGTCGGAAATGT
 
. : . : . : . : . : . :
JMSF038H13- CAGTTCCGTCGCCCCCCGAAGATCACATTGTCTTATGCGTTGGAGGTGCGACGGTGGACT
JMSF037H13- CAGTTCCGTCGCCCCCCGAAGATCGCATTGTCTTAGGCGTTGGAGGTGCGACGGTGGACT
                      ____________________________________________________________
consensus CAGTTCCGTCGCCCCCCGAAGATCGCATTGTCTTATGCGTTGGAGGTGCGACGGTGGACT
 
. : . : . : . : . : . :
JMSF038H13- TCTTGGCGGTGGTGGCTTCTTACCCTAAGCCCGATGATAAAATTCNAAGCACCAGCTTTG
JMSF037H13- TCTTGGCGGTGGTGGCTTCTTACCCTAAGCCCGATGATAAAATTCGAAGCACCAGCTTTG
                      ____________________________________________________________
consensus TCTTGGCGGTGGTGGCTTCTTACCCTAAGCCCGATGATAAAATTCGAAGCACCAGCTTTG
 
. : . : . : . : . : . :
JMSF038H13- AGGTTCAAGGAGGTGGCAACACTGGAAATGCTTTGACTTGTGCAGCTCGACTTGGCCTTA
JMSF037H13- AGGTTCAAGGAGGTGGCAACACTGGAAATGCTTTGACTTGTGCAGCTCGACTTGGCCTTA
                      ____________________________________________________________
consensus AGGTTCAAGGAGGTGGCAACACTGGAAATGCTTTGACTTGTGCAGCTCGACTTGGCCTTA
 
. : . : . : . : . : . :
JMSF038H13- ATCCAAGGATTATTTCCAAGGTTGCTAATGATGGACAAGGCAAAGGAATATTGGATGAAC
JMSF037H13- ATCCAAGGATTATTTCCAAGGTTGCTAATGATGGACAAGGCAAAGGAATATTGGATGAAC
                      ____________________________________________________________
consensus ATCCAAGGATTATTTCCAAGGTTGCTAATGATGGACAAGGCAAAGGAATATTGGATGAAC
 
. : . : . : . : . : . :
JMSF038H13- TANATGGGGATGGTGTTGACACNTCTTTCATGGNGGTATCCGAGGGAGGCAATTCACCTT
JMSF037H13- TAGATGGGGATGGTGTTGACACGTCTTTCATGGTGGTATCCGAGGGAGGCAATTCACCTT
rJMSF038H13+ GGCAATTCACCTT
                      ____________________________________________________________
consensus TAGATGGGGATGGTGTTGACACGTCTTTCATGGTGGTATCCGAGGGAGGCAATTCACCTT
 
. : . : . : . : . : . :
JMSF038H13- TCA
JMSF037H13- TCAGCTATCATTGTTGACAGTCAAACGAAAACTCGCACTTGCATACATACTCCAGGAGAG
rJMSF038H13+ TCAGCTATCATTGTTGACAGTCAAACGAAAACTCGCACTTGCATACATACTCCAGGAGAG
                      ____________________________________________________________
consensus TCAGCTATCATTGTTGACAGTCAAACGAAAACTCGCACTTGCATACATACTCCAGGAGAG
 
. : . : . : . : . : . :
JMSF037H13- CCACCCATGAAACCAGAAGAGCTATCCCAATCACATTTGCTATCTGCTATTGATGGAGCA
rJMSF038H13+ CCACCCATGAAACCAGAAGAGCTATCCCAATCACATTTGCTATCTGCTATTGATGGAGCA
                      ____________________________________________________________
consensus CCACCCATGAAACCAGAAGAGCTATCCCAATCACATTTGCTATCTGCTATTGATGGAGCA
 
. : . : . : . : . : . :
JMSF037H13- AGAATTGTCTATTTTGATGGAAGATTGTATGAAACTGCTTGCGTTGTGGCAAAGGAGGCA
rJMSF038H13+ AGAATTGTCTATTTTGATGGAAGATTGTATGAAACTGCTTGCGTTGTGGCAAAGGAGGCA
rJMSF037H13+ GCTTGCGTTGTGGCAAAGGAGGCA
                      ____________________________________________________________
consensus AGAATTGTCTATTTTGATGGAAGATTGTATGAAACTGCTTGCGTTGTGGCAAAGGAGGCA
 
. : . : . : . : . : . :
JMSF037H13- AGTAGTAGGAGCATACCCATTTTAGTTGATGCGGAAAGGGCAAGGGACGGACTGGATGAT
rJMSF038H13+ AGTAGTAGGAGCATACCCATTTTAGTTGATGCGGAAAGGGCAAGGGACGGACTGGATGAT
rJMSF037H13+ AGTAGTAGGAGCATACCCATTTTAGTTGATGCGGAAAGGGCAAGGGACGGACTGGATGAT
                      ____________________________________________________________
consensus AGTAGTAGGAGCATACCCATTTTAGTTGATGCGGAAAGGGCAAGGGACGGACTGGATGAT
 
. : . : . : . : . : . :
JMSF037H13- CTTTTGANCTTTGCTA
rJMSF038H13+ CTTTTGAACTTTGCTAGTTATGTTGTATGCTCAACAAAGTTTCCACAGGCATGGACCGAC
rJMSF037H13+ CTTTTGAACTTTGCTAGTTATGTTGTATGCTCAACAAAGTTTCCACAGGCATGGACCGAC
                      ____________________________________________________________
consensus CTTTTGAACTTTGCTAGTTATGTTGTATGCTCAACAAAGTTTCCACAGGCATGGACCGAC
 
. : . : . : . : . : . :
rJMSF038H13+ ACCCCTACTCTTCCAAGTGCACTTATTTCCATGCTTATACGATTACCAAATGTAAAATTT
rJMSF037H13+ ACCCCTACTCTTCCAAGTGCACTTATTTCCATGCTTATACGATTACCAAATGTAAAATTT
                      ____________________________________________________________
consensus ACCCCTACTCTTCCAAGTGCACTTATTTCCATGCTTATACGATTACCAAATGTAAAATTT
 
. : . : . : . : . : . :
rJMSF038H13+ GTGGTTGTGACATTGGGTGAAGAGGGTTGCATAATGCTAGAAAGGACTGAAACTGAGTCC
rJMSF037H13+ GTGGTTGTGACATTGGGTGAAGAGGGTTGCATAATGCTAGAAAGGACTGAAACTGAGTCC
                      ____________________________________________________________
consensus GTGGTTGTGACATTGGGTGAAGAGGGTTGCATAATGCTAGAAAGGACTGAAACTGAGTCC
 
. : . : . : . : . : . :
rJMSF038H13+ ACTCAATATGAAGAAATAGATATAGACGATTTGTATGAAATACTGAAGCAAAGGAAGGAT
rJMSF037H13+ ACTCAATATGAAGAAATAGATATAGACGATTTGTATGAAATACTGAAGCAAAGGAAGGAT
                      ____________________________________________________________
consensus ACTCAATATGAAGAAATAGATATAGACGATTTGTATGAAATACTGAAGCAAAGGAAGGAT
 
. : . : . : . : . : . :
rJMSF038H13+ GCTAACACAACCATCCCTACATGCATACCATCGAATGTGGCAAAACTGCGAGCAAAGGGA
rJMSF037H13+ GCTAACACAACCATCCCTACATGCATACCATCGAATGTGGCAAAACTGCGAGCAAAGGGA
                      ____________________________________________________________
consensus GCTAACACAACCATCCCTACATGCATACCATCGAATGTGGCAAAACTGCGAGCAAAGGGA
 
. : . : . : . : . : . :
rJMSF038H13+ GTAGGGATGGTTTGTGGTAGGCTACTTCTGGGAACAACTGAAAAGATACCGCCTTCTGAA
rJMSF037H13+ GTAGGGATGGTTTGTGGTAGGCTACTTCTGGGAACAACTGAAAAGATACCGCCTTCTGAA
                      ____________________________________________________________
consensus GTAGGGATGGTTTGTGGTAGGCTACTTCTGGGAACAACTGAAAAGATACCGCCTTCTGAA
 
. : . : . : . : . : . :
rJMSF038H13+ TTAGTTGATACAACCGGTGCTGGAGATGCATTTATCGGTGCAATCCTTTACTCAATCTGT
rJMSF037H13+ TTAGTTGATACAACCGGTGCTGGAGATGCATTTATCGGTGCAATCCTTTACTCAATCTGT
                      ____________________________________________________________
consensus TTAGTTGATACAACCGGTGCTGGAGATGCATTTATCGGTGCAATCCTTTACTCAATCTGT
 
. : . : . : . : . : . :
rJMSF038H13+ GCTGATATGCCCCCAGAAAAGATGCTGCCATTTGCTGCCCAAGTGGCAGCTATCGGTTGC
rJMSF037H13+ GCTGATATGCCCCCAGAAAAGATGCTGCCATTTGCTGCCCAAGTGGCAGCTATCGGTTGC
                      ____________________________________________________________
consensus GCTGATATGCCCCCAGAAAAGATGCTGCCATTTGCTGCCCAAGTGGCAGCTATCGGTTGC
 
. : . : . : . : . : . :
rJMSF038H13+ AGAGCCTTGGGTGCCCGAGCTGGTCTTCCCCGACGTGATGACCCTCGCTTGACACCTTTT
rJMSF037H13+ AGAGCCTTGGGTGCCCGAGCTGGTCTTCCCCGACGTGATGACCCTCGCTTGACACCTTTT
                      ____________________________________________________________
consensus AGAGCCTTGGGTGCCCGAGCTGGTCTTCCCCGACGTGATGACCCTCGCTTGACACCTTTT
 
. : . : . : . : . : . :
rJMSF038H13+ TTAGTGTAGGAGGGCGCCCGAGGGGTGCCCACAATATTGGTCTAGCAAGTCACAGAAACA
rJMSF037H13+ TTAGTGTAGGAGGGCGCCCGAGGGGTGCCCACAATATTGGTCTAGCAAGTCACAGAAACA
                      ____________________________________________________________
consensus TTAGTGTAGGAGGGCGCCCGAGGGGTGCCCACAATATTGGTCTAGCAAGTCACAGAAACA
 
. : . : . : . : . : . :
rJMSF038H13+ AAAGGATTGTGCTTTTTCTTGTCATGTTCTTGTCCGGGTTTCTCTGGACTGACATTCTGT
rJMSF037H13+ AAAGGATTGTGCTTTTTCTTGTCATGTTCTTGTCCGGGTTTCTCTGGACTGACATTCTGT
                      ____________________________________________________________
consensus AAAGGATTGTGCTTTTTCTTGTCATGTTCTTGTCCGGGTTTCTCTGGACTGACATTCTGT