Previous Contig 013106:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS048H09Sequence610013106 (4)gb:BT012655_16417252e-42Arabidopsis thaliana At1g10120 gene, complete cds.
JMSF037H02Sequence674006182 (3)783013106 (4)pir|T00632|T006322e-12hypothetical protein T27I1.15 - Arabidopsis thaliana>gb:AE005172_890016 Arabidop
JMSF045D21Sequence697020297793013106 (4)gb:BT012655_16417257e-33Arabidopsis thaliana At1g10120 gene, complete cds.
JMSF053G23Sequence609006182 (3)860013106 (4)pir|T00632|T006323e-12hypothetical protein T27I1.15 - Arabidopsis thaliana>gb:AE005172_890016 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS048H09- ACCCCCTAAAGAAAATTAT
                      ____________________________________________________________
consensus ACCCCCTAAAGAAAATTAT
 
. : . : . : . : . : . :
JMFS048H09- GTTCATGTAAGGGCTAAACGCGGGCAGGCTACAAACAGCCACAGCCTTGCCGAAAGGGTG
                      ____________________________________________________________
consensus GTTCATGTAAGGGCTAAACGCGGGCAGGCTACAAACAGCCACAGCCTTGCCGAAAGGGTG
 
. : . : . : . : . : . :
JMFS048H09- AGACGAGAAAGGATCAGTGAAAGAATGAGATTGCTTCAAGAACTAGTTCCGGGCTGCAAT
                      ____________________________________________________________
consensus AGACGAGAAAGGATCAGTGAAAGAATGAGATTGCTTCAAGAACTAGTTCCGGGCTGCAAT
 
. : . : . : . : . : . :
JMFS048H09- AAGATCACTGGGAAAGCGGTGATGCTTGACGAGATTATTAACTATGTGCAGTCACTTCAG
                      ____________________________________________________________
consensus AAGATCACTGGGAAAGCGGTGATGCTTGACGAGATTATTAACTATGTGCAGTCACTTCAG
 
. : . : . : . : . : . :
JMFS048H09- CAACAAGTCGAGTTTCTGTCGATGAAACTTGCTACTGTGAATCCCGAGCTGAACTTTGAT
rJMSF045D21+ AGTTTCTGTCGATGAAACTTGCTACTGTGAATCCCGAGCTGAACTTTGAT
rJMSF053G23+ AGTTTCTGTCGATGAAACTTGCTACTGTGAATCCCGAGCTGAACTTTGAT
rJMSF037H02+ AGTTTCTGTCGATGAAACTTGCTACTGTGAATCCCGAGCTGAACTTTGAT
                      ____________________________________________________________
consensus CAACAAGTCGAGTTTCTGTCGATGAAACTTGCTACTGTGAATCCCGAGCTGAACTTTGAT
 
. : . : . : . : . : . :
JMFS048H09- ATCGAACGAATATTATCCAAAGATATTCTTCACGCACAAGGAAACAATGGAGCTCTTCTC
rJMSF045D21+ ATCGAACGAATATTATCCAAAGATATTCTTCACGCACAAGGAAACAATGGAGCTCTTCTC
rJMSF053G23+ ATCGAACGAATATTATCCAAAGATATTCTTCACGCACAAGGAAACAATGGAGCTCTTCTC
rJMSF037H02+ ATCGAACGAATATTATCCAAAGATATTCTTCACGCACAAGGAAACAATGGAGCTCTTCTC
                      ____________________________________________________________
consensus ATCGAACGAATATTATCCAAAGATATTCTTCACGCACAAGGAAACAATGGAGCTCTTCTC
 
. : . : . : . : . : . :
JMFS048H09- GGACTTGGCCCGGGATTGAACTCACCACATCCTTTCCCCGGTGCTCCACTGGGAACATTC
rJMSF045D21+ GGACTTGGCCCGGGATTGAACTCACCACATCCTTTCCCCGGTGCTCCACTGGGAACATTC
rJMSF053G23+ GGACTTGGCCCGGGATTGAACTCACCACATCCTTTCCCCGGTGCTCCACTGGGAACATTC
rJMSF037H02+ GGACTTGGCCCGGGATTGAACTCACCACATCCTTTCCCCGGTGCTCCACTGGGAACATTC
                      ____________________________________________________________
consensus GGACTTGGCCCGGGATTGAACTCACCACATCCTTTCCCCGGTGCTCCACTGGGAACATTC
 
. : . : . : . : . : . :
JMFS048H09- AATAATGTCCCCAACGCCACGCCATTTCACTCATTGCCTCAGAATGTGTGGGAGAACGAT
rJMSF045D21+ AATAATGTCCCCAACGCCACGCCATTTCACTCATTGCCTCAGAATGTGTGGGAGAACGAT
rJMSF053G23+ AATAATGTCCCCAACGCCACGCCATTTCACTCATTGCCTCAGAATGTGTGGGAGAACGAT
rJMSF037H02+ AATAATGTCCCCAACGCCACGCCATTTCACTCATTGCCTCAGAATGTGTGGGAGAACGAT
                      ____________________________________________________________
consensus AATAATGTCCCCAACGCCACGCCATTTCACTCATTGCCTCAGAATGTGTGGGAGAACGAT
 
. : . : . : . : . : . :
JMFS048H09- CTCCAGAGTATTCTCCAGATGGGATTTGATTCTAACTCTTCTTTGAACAACATGGGACCA
rJMSF045D21+ CTCCAGAGTATTCTCCAGATGGGATTTGATTCTAACTCTTCTTTGAACAACATGGGACCA
rJMSF053G23+ CTCCAGAGTATTCTCCAGATGGGATTTGATTCTAACTCTTCTTTGAACAACATGGGACCA
rJMSF037H02+ CTCCAGAGTATTCTCCAGATGGGATTTGATTCTAACTCTTCTTTGAACAACATGGGACCA
                      ____________________________________________________________
consensus CTCCAGAGTATTCTCCAGATGGGATTTGATTCTAACTCTTCTTTGAACAACATGGGACCA
 
. : . : . : . : . : . :
JMFS048H09- AACGGTAATCGTTCATAGGACATATAGCGATATTTGTTGATCTTGTATTCACCCTCGGTT
rJMSF045D21+ AACGGTAATCGTTCATAGGACATATAGCGATATTTGTTGATCTTGTATTCACCCTCGGTT
rJMSF053G23+ AACGGTAATCGTTCATAGGACATATAGCGATATTTGTTGATCTTGTATTCACCCTCGGTT
rJMSF037H02+ AACGGTAATCGTTCATAGGACATATAGCGATATTTGTTGATCTTGTATTCACCCTCGGTT
                      ____________________________________________________________
consensus AACGGTAATCGTTCATAGGACATATAGCGATATTTGTTGATCTTGTATTCACCCTCGGTT
 
. : . : . : . : . : . :
JMFS048H09- CTGGCGTTTTCCCCTCCAAACATAAAGATAGATGTCTCGATCGATCGAGCT
rJMSF045D21+ CTGGCGTTTTCCCCTCCAAACATAAAGATAGATGTCTCGATCGATCGAGCTGATTAGCAG
rJMSF053G23+ CTGGCGTTTTCCCCTCCAAACATAAAGATAGATGTCTCGATCGATCGAGCTGATTAGCAG
rJMSF037H02+ CTGGCGTTTTCCCCTCCAAACATAAAGATAGATGTCTCGATCGATCGAGCTGATTAGCAG
                      ____________________________________________________________
consensus CTGGCGTTTTCCCCTCCAAACATAAAGATAGATGTCTCGATCGATCGAGCTGATTAGCAG
 
. : . : . : . : . : . :
rJMSF045D21+ GGTGGTGAAGAATGGATTTGTAGATTTCTGGGAATGCTAGCTGCTGTCAACTAATGCCTT
rJMSF053G23+ GGTGGTGAAGAATGGATTTGTAGATTTCTGGGAATGCTAGCTGCTGTCAACTAATGCCTT
rJMSF037H02+ GGTGGTGAAGAATGGATTTGTAGATTTCTGGGAATGCTAGCTGCTGTCAACTAATGCCTT
                      ____________________________________________________________
consensus GGTGGTGAAGAATGGATTTGTAGATTTCTGGGAATGCTAGCTGCTGTCAACTAATGCCTT
 
. : . : . : . : . : . :
rJMSF045D21+ AACTCTTCACTGCTGAATTTGTTTCTTTCCACTGGACAACAAAAAAGTAGCTATACATAA
rJMSF053G23+ AACTCTTCACTGCTGAATTTGTTTCTTTCCACTGGACAACAAAAAAGTAGCTATACATAA
rJMSF037H02+ AACTCTTCACTGCTGAATTTGTTTCTTTCCACTGGACAACAAAAAAGTAGCTATACATAA
                      ____________________________________________________________
consensus AACTCTTCACTGCTGAATTTGTTTCTTTCCACTGGACAACAAAAAAGTAGCTATACATAA
 
. : . : . : . : . : . :
rJMSF045D21+ TTTTCAGAGATGTATAGGTTGTTTAGCTCCTAACTCTTTGTTCTTCGAATTTTAGCAGAA
rJMSF053G23+ TTTTCAGAGATGTATAGGTTGTTTAGCTCCTAACTCTTTGTTCTTCGAATTTTAGCAGAA
rJMSF037H02+ TTTTCAGAGATGTATAGGTTGTTTAGCTCCTAACTCTTTGTTCTTCGAATTTTAGCAGAA
                      ____________________________________________________________
consensus TTTTCAGAGATGTATAGGTTGTTTAGCTCCTAACTCTTTGTTCTTCGAATTTTAGCAGAA
 
. : . : . : . : . : . :
rJMSF045D21+ GAAATGGCATTTCATATTTAAAATGGGGTTGTCTGTATGTGTT
rJMSF053G23+ GAAATGGCATTTCATATTTAAAATGGGGTTGTCTGTATGTGTTTAGCTTCATGC
rJMSF037H02+ GAAATGGCATTTCATATTTAAAATGGGGTTGTCTGTATGTGTTTAGCTTCATGCGGATTT
                      ____________________________________________________________
consensus GAAATGGCATTTCATATTTAAAATGGGGTTGTCTGTATGTGTTTAGCTTCATGCGGATTT