Previous Contig 013101:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037G07Sequence659013101 (2)sp|Q9ZTN2|ERD2_PETHY3e-73ER lumen protein retaining receptor (HDEL receptor) (PGP169-12).>gb:AF049922_176763013101 (2)sp|Q9ZTN2|ERD2_PETHY4e-68ER lumen protein retaining receptor (HDEL receptor) (PGP169-12).>gb:AF049922_176

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037G07- GAAGCAAAACCGCAAAAGCCCAAAATTGAGCTTCCAT
                      ____________________________________________________________
consensus GAAGCAAAACCGCAAAAGCCCAAAATTGAGCTTCCAT
 
. : . : . : . : . : . :
JMSF037G07- TTCTGCAACTCAAAACTTAAAACTGCTAGGCGAAAAACATTCAGAGCAAAATGAACATTT
                      ____________________________________________________________
consensus TTCTGCAACTCAAAACTTAAAACTGCTAGGCGAAAAACATTCAGAGCAAAATGAACATTT
 
. : . : . : . : . : . :
JMSF037G07- TCCGGTTAGCCGGCGACATGACCCACCTCCTCAGCATCATAGTGCTCCTCCTCAAAATTC
                      ____________________________________________________________
consensus TCCGGTTAGCCGGCGACATGACCCACCTCCTCAGCATCATAGTGCTCCTCCTCAAAATTC
 
. : . : . : . : . : . :
JMSF037G07- GTACTAAGAAATCCTGCGCAGGGATTTCATTGAAGACTCAAGAACTTTATGTTATAGTCT
rJMSF037G07+ AGACTCAAGAACTTTATGTTATAGTCT
                      ____________________________________________________________
consensus GTACTAAGAAATCCTGCGCAGGGATTTCATTGAAGACTCAAGAACTTTATGTTATAGTCT
 
. : . : . : . : . : . :
JMSF037G07- TTCTCACTCGATACCTGGACTTATTTACCAGAGTTTACTCTTTCTACAACACTATAATGA
rJMSF037G07+ TTCTCACTCGATACCTGGACTTATTTACCAGAGTTTACTCTTTCTACAACACTATAATGA
                      ____________________________________________________________
consensus TTCTCACTCGATACCTGGACTTATTTACCAGAGTTTACTCTTTCTACAACACTATAATGA
 
. : . : . : . : . : . :
JMSF037G07- AACTAGTCTTTATTGGAACCTCACTCAGTATAGTTTGGTACATGAGGTTCCATAAAGTAG
rJMSF037G07+ AACTAGTCTTTATTGGAACCTCACTCAGTATAGTTTGGTACATGAGGTTCCATAAAGTAG
                      ____________________________________________________________
consensus AACTAGTCTTTATTGGAACCTCACTCAGTATAGTTTGGTACATGAGGTTCCATAAAGTAG
 
. : . : . : . : . : . :
JMSF037G07- TCAAGCAAACATACAGCAAGGATCAAGATACTTTCCGACACTATTTTTTGATTGTACCAT
rJMSF037G07+ TCAAGCAAACATACAGCAAGGATCAAGATACTTTCCGACACTATTTTTTGATTGTACCAT
                      ____________________________________________________________
consensus TCAAGCAAACATACAGCAAGGATCAAGATACTTTCCGACACTATTTTTTGATTGTACCAT
 
. : . : . : . : . : . :
JMSF037G07- GTTTCCTATTGGCACTTTTGGTTAACCATGAATTCACTGTGATGGAGTTACTTTGGACTT
rJMSF037G07+ GTTTCCTATTGGCACTTTTGGTTAACCATGAATTCACTGTGATGGAGTTACTTTGGACTT
                      ____________________________________________________________
consensus GTTTCCTATTGGCACTTTTGGTTAACCATGAATTCACTGTGATGGAGTTACTTTGGACTT
 
. : . : . : . : . : . :
JMSF037G07- TCTCCCTGTATCTTGAAGCAATAGCAATTCTACCTCAGTTGATATTACTGCAACGATCGA
rJMSF037G07+ TCTCCCTGTATCTTGAAGCAATAGCAATTCTACCTCAGTTGATATTACTGCAACGATCGA
                      ____________________________________________________________
consensus TCTCCCTGTATCTTGAAGCAATAGCAATTCTACCTCAGTTGATATTACTGCAACGATCGA
 
. : . : . : . : . : . :
JMSF037G07- AGAACATTGACAACTTGACTGGAAGATATATATTTCTTCTTGGTTCTTACCGAGCTTTTT
rJMSF037G07+ AGAACATTGACAACTTGACTGGAAGATATATATTTCTTCTTGGTTCTTACCGAGCTTTTT
                      ____________________________________________________________
consensus AGAACATTGACAACTTGACTGGAAGATATATATTTCTTCTTGGTTCTTACCGAGCTTTTT
 
. : . : . : . : . : . :
JMSF037G07- ACATCATCAATTGGATCTATCGTTTCTTTTTGGAAAATCATCAATACCACTGGATCCCTT
rJMSF037G07+ ACATCATCAATTGGATCTATCGTTTCTTTTTGGAAAATCATCAATACCACTGGATCCCTT
                      ____________________________________________________________
consensus ACATCATCAATTGGATCTATCGTTTCTTTTTGGAAAATCATCAATACCACTGGATCCCTT
 
. : . : . : . : . : . :
JMSF037G07- GGATTTCTGGCGTTGTTCAGAC
rJMSF037G07+ GGATTTCTGGCGTTGTTCAGACTGCTCTTTATGCTGACTTCTTCTACTATTACATAAAGA
                      ____________________________________________________________
consensus GGATTTCTGGCGTTGTTCAGACTGCTCTTTATGCTGACTTCTTCTACTATTACATAAAGA
 
. : . : . : . : . : . :
rJMSF037G07+ GCTGGAAGAGCAATGAAAGCCTCAAGCTTCCTGGCTGACTTGTACATTTATCAGTTTGGG
                      ____________________________________________________________
consensus GCTGGAAGAGCAATGAAAGCCTCAAGCTTCCTGGCTGACTTGTACATTTATCAGTTTGGG
 
. : . : . : . : . : . :
rJMSF037G07+ TTACGATGAAAGGGAAAGGCTGTTCTGCATAAGAGCGATAAAAATCTTGAAGTTTTTGTA
                      ____________________________________________________________
consensus TTACGATGAAAGGGAAAGGCTGTTCTGCATAAGAGCGATAAAAATCTTGAAGTTTTTGTA
 
. : . : . : . : . : . :
rJMSF037G07+ TCTTCATAGGCTAACTATCCACTCCTCACCCCCTATGCCTTCCCTTTATGGTATCAGCAA
                      ____________________________________________________________
consensus TCTTCATAGGCTAACTATCCACTCCTCACCCCCTATGCCTTCCCTTTATGGTATCAGCAA
 
. : . : . : . : . : . :
rJMSF037G07+ GCCACAACTTAGAATAATTGCTTTGTTCTATTTTTCAGTGACCAGTGTACTACCAGTTCC
                      ____________________________________________________________
consensus GCCACAACTTAGAATAATTGCTTTGTTCTATTTTTCAGTGACCAGTGTACTACCAGTTCC