Previous Contig 013092:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN020E01Sequence589013092 (8)gb:AY087802_15728292e-16Arabidopsis thaliana clone 38529 mRNA, complete sequence.
JMFN020O12Sequence624013092 (8)gb:AF509872_18070761e-37Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.
JMSF015E13Sequence521007635 (7)gb:AF509872_18070769e-72Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.750013092 (8)gb:AY087802_15728292e-21Arabidopsis thaliana clone 38529 mRNA, complete sequence.
JMSF018I01Sequence456007635 (7)gb:AF509872_18070765e-19Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.748013092 (8)gb:AY087802_15728299e-24Arabidopsis thaliana clone 38529 mRNA, complete sequence.
JMSF028I02Sequence624007635 (7)gb:AF509872_18070761e-79Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.688013092 (8)gb:AY087802_15728295e-21Arabidopsis thaliana clone 38529 mRNA, complete sequence.
JMSF037E11Sequence636007635 (7)gb:AF509872_18070765e-86Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.770013092 (8)gb:AY087802_15728292e-21Arabidopsis thaliana clone 38529 mRNA, complete sequence.
JMSF041A10Sequence740007635 (7)gb:AF509872_1807076e-100Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.782013092 (8)gb:AY087802_15728296e-24Arabidopsis thaliana clone 38529 mRNA, complete sequence.
JMSF044N18Sequence691007635 (7)gb:AF509872_18070762e-92Petunia x hybrida nam-like protein 9 (NH9) mRNA, complete cds.699013092 (8)gb:AY087802_15728294e-20Arabidopsis thaliana clone 38529 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN020O12- CCTTGCGGACAGCAACATCCTGATGAGCTGAAGC
                      ____________________________________________________________
consensus CCTTGCGGACAGCAACATCCTGATGAGCTGAAGC
 
. : . : . : . : . : . :
JMFN020O12- CCTTTGATCAACCAATTCATGATTTTGATCCCAAGCCTGTCAAACGAGAGTACATGGGCG
                      ____________________________________________________________
consensus CCTTTGATCAACCAATTCATGATTTTGATCCCAAGCCTGTCAAACGAGAGTACATGGGCG
 
. : . : . : . : . : . :
JMFN020O12- AGTCTAGCAATAGCATGACCTCTGAAAGTTTGAATTGCTTACTCAATGAACCACTCATGG
                      ____________________________________________________________
consensus AGTCTAGCAATAGCATGACCTCTGAAAGTTTGAATTGCTTACTCAATGAACCACTCATGG
 
. : . : . : . : . : . :
JMFN020O12- ACACTACCGACAGATTTCAGTTCAATGATGGAACATTTCTTGAAACTAATGATCTTTCAA
                      ____________________________________________________________
consensus ACACTACCGACAGATTTCAGTTCAATGATGGAACATTTCTTGAAACTAATGATCTTTCAA
 
. : . : . : . : . : . :
JMFN020O12- ATCCTGTCGAAGGAAATACCTCAGGCTTCGACATGTTTGACTTCC-TTAATTTCTATGAT
rJMSF041A10+ AATACNTCAGGCTTCGACATGTTTGACTTCCNTAAATTTCTATGAT
rJMSF018I01+ TATGAT
                      ____________________________________________________________
consensus ATCCTGTCGAAGGAAATACCTCAGGCTTCGACATGTTTGACTTCCNTTAATTTCTATGAT
 
. : . : . : . : . : . :
JMFN020O12- GCCAAGGATGATTTCCAAGACATGCTGTTTGATTCTGATATATTTATTGGAAATGATGAG
rJMSF041A10+ GCCANGGATGATTTCCAAGACATGCTGTTTGATTCTGATATATTTATTGGAAATGATGAG
rJMSF018I01+ GCCAAGGATGATTTCCAAGACATGCTGTTTGATTCTGATATATTTATTGGAAATGACGAG
                      ____________________________________________________________
consensus GCCAAGGATGATTTCCAAGACATGCTGTTTGATTCTGATATATTTATTGGAAATGATGAG
 
. : . : . : . : . : . :
JMFN020O12- TTTCTTGGAGAACAATCACCTTCTGCTGATAAGGATGCATGCGACACAACTGAACAGGCT
rJMSF041A10+ TTTCTTGGAGAACAATCACCTTCTGCTGATAAGGATGCATGCGACACAACTGAACAGGCT
rJMSF018I01+ TTTCTTGGAGAACAATCACCTTCTGCTGATAAGGATGCATGCGACACAACTGAACAGGCT
rJMSF015E13+ CTGATAAGGATGCATGCGACACAACTGAACAGGCT
rJMSF037E11+ AGAACAATCACCTTCTGCTGATAAGGATGCATGCGACACAACTGAACAGGCT
                      ____________________________________________________________
consensus TTTCTTGGAGAACAATCACCTTCTGCTGATAAGGATGCATGCGACACAACTGAACAGGCT
 
. : . : . : . : . : . :
JMFN020O12- GTTTTGCCCAACGAAAAGGCCGTTGATACTGAACATAAGAATGATATT-GCATCATCGTC
rJMSF041A10+ GTTTTGCCCAACGAAAAGGCCGTTGATACTGAACATAAGAATGATATT-GCATCATCGTC
rJMSF018I01+ GTTTTGCCCAACGAAAAGGCCGTTGATACTGAACATAAGAATGATATT-GCATCATCGTC
rJMSF015E13+ GTTTTGCCCAACGAAAAGGCCGTTGATACTGAACATAAGAATGATATT-GCATCATCGTC
rJMSF028I02+ CTGAACATAAGAATGATATT-GCATCATCGTC
rJMSF044N18+ CCGTTGATACTGAACATAAGAATGATATTNGCATCATCGTC
rJMSF037E11+ GTTTTGCCCAACGAAAAGGCCGTTGATACTGAACATAAGAATGATATT-GCATCATCGTC
                      ____________________________________________________________
consensus GTTTTGCCCAACGAAAAGGCCGTTGATACTGAACATAAGAATGATATT-GCATCATCGTC
 
. : . : . : . : . : . :
JMFN020O12- AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
rJMSF041A10+ AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
rJMSF018I01+ AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
JMFN020E01- GCCAG
rJMSF015E13+ AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
rJMSF028I02+ AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
rJMSF044N18+ AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
rJMSF037E11+ AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
                      ____________________________________________________________
consensus AAAGCCAGAGCCCACCAAATTGGGGTCAGACTTCCAACATCCATTTATCAAGCAGGCCAG
 
. : . : . : . : . : . :
JMFN020O12- CCAAATGTTGGGCAACATACCCGCTTCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
rJMSF041A10+ CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
rJMSF018I01+ CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
JMFN020E01- CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
rJMSF015E13+ CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
rJMSF028I02+ CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
rJMSF044N18+ CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
rJMSF037E11+ CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
                      ____________________________________________________________
consensus CCAAATGTTGGGCAACATACCCGCTCCTCCAGCATTTGCATCAGAGATCCCAAAAGATGC
 
. : . : . : . : . : . :
JMFN020O12- AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACT
rJMSF041A10+ AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
rJMSF018I01+ AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
JMFN020E01- AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
rJMSF015E13+ AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
rJMSF028I02+ AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
rJMSF044N18+ AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
rJMSF037E11+ AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
                      ____________________________________________________________
consensus AGCTCTGCGCCTCAATGCAGCAACCCAAGCATCAAGCTCAGTGCACGTTACTGCTGGTCT
 
. : . : . : . : . : . :
rJMSF041A10+ GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
rJMSF018I01+ GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACACCATCATCCTTTC
JMFN020E01- GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
rJMSF015E13+ GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
rJMSF028I02+ GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
rJMSF044N18+ GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
rJMSF037E11+ GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
                      ____________________________________________________________
consensus GATTCAAATCAGCGACCTGACTCTCGGCAGCAAGCATGGCAATTACAACATCATCCTTTC
 
. : . : . : . : . : . :
rJMSF041A10+ TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
rJMSF018I01+ TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
JMFN020E01- TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
rJMSF015E13+ TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
rJMSF028I02+ TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
rJMSF044N18+ TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
rJMSF037E11+ TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
                      ____________________________________________________________
consensus TTTCGACTTCTCACAAGGTGCACAAAGTCCAGGCAGCTTGGAACCAGTGAGCCACGGGAA
 
. : . : . : . : . : . :
rJMSF041A10+ GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
rJMSF018I01+ GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
JMFN020E01- GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
rJMSF015E13+ GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
rJMSF028I02+ GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
rJMSF044N18+ GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
rJMSF037E11+ GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
                      ____________________________________________________________
consensus GATGCTATCTGGGGGTTGGTTCTACTTTCTTCTCTTCTGGGTTCTAATCCTCTCCATTTC
 
. : . : . : . : . : . :
rJMSF041A10+ CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
rJMSF018I01+ CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
JMFN020E01- CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
rJMSF015E13+ CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
rJMSF028I02+ CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
rJMSF044N18+ CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
rJMSF037E11+ CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
                      ____________________________________________________________
consensus CGTCAAGGTTGGAACCTTCATCTATGCAAGGTAATCTTATGCATCCATCATCAGGGAAGT
 
. : . : . : . : . : . :
rJMSF041A10+ GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
rJMSF018I01+ GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
JMFN020E01- GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
rJMSF015E13+ GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
rJMSF028I02+ GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
rJMSF044N18+ GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
rJMSF037E11+ GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
                      ____________________________________________________________
consensus GGAACTTTTGCTGCAACATTCCCCAGGACTTGTGGTATCTATTTAGGTGCTGGTACTGGT
 
. : . : . : . : . : . :
rJMSF041A10+ AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
rJMSF018I01+ AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
JMFN020E01- AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
rJMSF015E13+ AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
rJMSF028I02+ AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
rJMSF044N18+ AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
rJMSF037E11+ AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
                      ____________________________________________________________
consensus AGGGGATTTTGAGTACATTTGTTACTATTAGTATAACAAATTGTCTGAAAAAACAGTACA
 
. : . : . : . : . : . :
rJMSF041A10+ CATCAGACTGGTGACTT
rJMSF018I01+ CATCAGACTGGTGACTTTGCGT
JMFN020E01- CATCAGACTGGTGACTTTGCGTTCTCAGGGTTTTGTGAATTGGAAAAGCTTTAACAGTCT
rJMSF015E13+ CATCAGACTGGTGACTTTGCGTTCTCAGGGTTTTGTGAATTGGAAAAGCTTTAACAGTCT
rJMSF028I02+ CATCAGACTGGTGACTTTGCGTTCTCAGGGTTTTGTGAATTGGAAAAGCTTTAACAGTCT
rJMSF044N18+ CATCAGACTGGTGACTTTGCGTTCTCAGGGTTTTGTGAATTGGAAAAGCTTTAACAGTCT
rJMSF037E11+ CATCAGACTGGTGACTTTGCGTTCTCAGGGTTTTGTGAATTGGAAAAGCTTTAACAGTCT
                      ____________________________________________________________
consensus CATCAGACTGGTGACTTTGCGTTCTCAGGGTTTTGTGAATTGGAAAAGCTTTAACAGTCT
 
. : . : . : . : . : . :
JMFN020E01- AAGTTAGTCAAATATATATCATAGAACTC-GCTGGTTCTA
rJMSF015E13+ AAGTTAGTCAAATATATATCATAGAACTC-GCTGGTTCTATATTTAATCCCT
rJMSF028I02+ AAGTTAGTCAAATATATATCATAGAACTC-GCTGGTTCTATATTTAATCCCT
rJMSF044N18+ AAGTTAGTCAAATATATATCATAGAACTCGGCTGGTTCTATATTTAATCCCT
rJMSF037E11+ AAGTTAGTCAAATATATATCATAGAACTC-GCTGGTTCTATATTTAATCCCTAACTTGAA
                      ____________________________________________________________
consensus AAGTTAGTCAAATATATATCATAGAACTC-GCTGGTTCTATATTTAATCCCTAACTTGAA