Previous Contig 013091:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002M14Sequence346013091 (4)727013091 (4)gb:AY051082_15625536e-52Arabidopsis thaliana unknown protein (At1g07700) mRNA, complete cds.>gb:AF360345
JMSF037E04Sequence639013091 (4)gb:AP006068_18608731e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002735013091 (4)gb:AY051082_15625536e-52Arabidopsis thaliana unknown protein (At1g07700) mRNA, complete cds.>gb:AF360345

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037E04- GGA
                      ____________________________________________________________
consensus GGA
 
. : . : . : . : . : . :
JMSF002M14- CTTGGCGTCATGTGTATGACATGAGAAACTGGATTGAAGAAACCATGGAAAGGTGGTG
JMSF037E04- TACTTGGCGTCATGTGTATGACATGAGAAACTGGATTGAAGAAACCATGGAAAGGTGGTG
                      ____________________________________________________________
consensus TACTTGGCGTCATGTGTATGACATGAGAAACTGGATTGAAGAAACCATGGAAAGGTGGTG
 
. : . : . : . : . : . :
JMSF002M14- ATCTCATATAGTGATATGTGAGAGAACAGTTGGTTCAGGTTCAAGGTTTTATATATTGTA
JMSF037E04- ATCTCATATAGTGATATGTGAGAGAACAGTTGGTTCAGGTTCAAGGTTTTATATATTGTA
                      ____________________________________________________________
consensus ATCTCATATAGTGATATGTGAGAGAACAGTTGGTTCAGGTTCAAGGTTTTATATATTGTA
 
. : . : . : . : . : . :
JMSF002M14- AAAATTCTTGAAATCTACGTGGGAATGGTGGATGAAGAGGTTGATTTTGTAAGGTTTGCA
JMSF037E04- AAAATTCTTGAAATCTACGTGGGAATGGTGGATGAAGAGGTTGATTTTGTAAGGTTTGCA
                      ____________________________________________________________
consensus AAAATTCTTGAAATCTACGTGGGAATGGTGGATGAAGAGGTTGATTTTGTAAGGTTTGCA
 
. : . : . : . : . : . :
JMSF002M14- ACTTGCACTCATGCAAAGGCTGAGTGTTCTTGGTTGTAAGGCCTCTTTTGGCTTTGGGAG
JMSF037E04- ACTTGCACTCATGCAAAGGCTGAGTGTTCTTGGTTGTAAGGCCTCTTTTGGCTTTGGGAG
                      ____________________________________________________________
consensus ACTTGCACTCATGCAAAGGCTGAGTGTTCTTGGTTGTAAGGCCTCTTTTGGCTTTGGGAG
 
. : . : . : . : . : . :
JMSF002M14- AAGCTTTAATGATCAAAAACTAGGTTGTTTAGCTGGATCAATATTGCCCATTATACGTAA
JMSF037E04- AAGCTTTAATGATCAAAAACTAGGTTGTTTAGCTGGATCAATATTGCCCATTATACGTAA
rJMSF002M14+ CTGGATCAATATTGCCCATTATACGTAA
                      ____________________________________________________________
consensus AAGCTTTAATGATCAAAAACTAGGTTGTTTAGCTGGATCAATATTGCCCATTATACGTAA
 
. : . : . : . : . : . :
JMSF002M14- AAATGCTATTGAGTCTTGTTATATAAAGACACGAGGTGTGTTTA
JMSF037E04- AAATGCTATTGAGTCTTGTTATATAAAGACACGAGGTGTGTTTAGGCTTGGAAATGTCGA
rJMSF002M14+ AAATGCTATTGAGTCTTGTTATATAAAGACACGAGGTGTGTTTAGGCTTGGAAATGTCGA
rJMSF037E04+ TGGAAATGTCGA
                      ____________________________________________________________
consensus AAATGCTATTGAGTCTTGTTATATAAAGACACGAGGTGTGTTTAGGCTTGGAAATGTCGA
 
. : . : . : . : . : . :
JMSF037E04- GAAACAAATTTGTGCAGTTAGGTCCTCGAGGATATGGAGTGTGAATAATGATAATGTTGA
rJMSF002M14+ GAAACAAATTTGTGCAGTTTGGTCCTCGAGGATATGGAGTGTGAATAATGATAATGTTGA
rJMSF037E04+ GAAACAAATTTGTGCAGTTANGTCCTCGAGGATATGGAGTGTGAATAATGATAATGTTGA
                      ____________________________________________________________
consensus GAAACAAATTTGTGCAGTTAGGTCCTCGAGGATATGGAGTGTGAATAATGATAATGTTGA
 
. : . : . : . : . : . :
JMSF037E04- TGAATTATTTAATGGCGGTGGTGATGAAGATGATGATGATGAGTTGTGCCCGGTTGAATG
rJMSF002M14+ TGAATTATTTAATGGCGGTGGTGATGAAGATGATGATGATGAGTTGTGCCCGGTTGAATG
rJMSF037E04+ TGAATTATTTAATGGCGGTGGTGATGAAGATGATGATGATGAGTTGTGCCCGGTTGAATG
                      ____________________________________________________________
consensus TGAATTATTTAATGGCGGTGGTGATGAAGATGATGATGATGAGTTGTGCCCGGTTGAATG
 
. : . : . : . : . : . :
JMSF037E04- CGTGAGAGAATTTAACACGGATGAGGAATTCTCGAGAATAATGGAGAAGGCAAAGCAAAC
rJMSF002M14+ CGTGAGAGAATTTAACACGGATGAGGAATTCTCGAGAATAATGGAGAAGGCAAAGCAAAC
rJMSF037E04+ CGTGAGAGAATTTAACACGGATGAGGAATTCTCGAGAATAATGGAGAAGGCAAAGCAAAC
                      ____________________________________________________________
consensus CGTGAGAGAATTTAACACGGATGAGGAATTCTCGAGAATAATGGAGAAGGCAAAGCAAAC
 
. : . : . : . : . : . :
JMSF037E04- TGGCGCTCTGGTTGTGGTGGACTTCTACCGCACGTCTTGTGGCAGCTGCAAGTACATCGA
rJMSF002M14+ TGGCGCTCTGGTTGTGGTGGACTTCTACCGCACGTCTTGTGGCAGCTGCAAGTACATCGA
rJMSF037E04+ TGGCGCTCTGGTTGTGGTGGACTTCTACCGCACGTCTTGTGGCAGCTGCAAGTACATCGA
                      ____________________________________________________________
consensus TGGCGCTCTGGTTGTGGTGGACTTCTACCGCACGTCTTGTGGCAGCTGCAAGTACATCGA
 
. : . : . : . : . : . :
JMSF037E04- GCAGGGATTCGTGAAGCTCTGCAAGGGATCCGGTGA
rJMSF002M14+ GCAGGGATTCGTGAAGCTCTGCAAGGGATCCGGTGACGAAGAGGCACCCGTTGTTTTCTT
rJMSF037E04+ GCAGGGATTCGTGAAGCTCTGCAAGGGATCCGGTGACGAAGAGGCACCCGTTGTTTTCTT
                      ____________________________________________________________
consensus GCAGGGATTCGTGAAGCTCTGCAAGGGATCCGGTGACGAAGAGGCACCCGTTGTTTTCTT
 
. : . : . : . : . : . :
rJMSF002M14+ GAAACACAATGTGCTTGATGAGTACGATGAACAATCCGAGGTTGCAGAACGCCTTCGAAT
rJMSF037E04+ GAAACACAATGTGCTTGATGAGTACGATGAACAATCCGAGGTTGCAGAACGCCTTCGAAT
                      ____________________________________________________________
consensus GAAACACAATGTGCTTGATGAGTACGATGAACAATCCGAGGTTGCAGAACGCCTTCGAAT
 
. : . : . : . : . : . :
rJMSF002M14+ CAGGTCTGTGCCCCTCTTTCATTTCTACAAGAACGGAGTGCTACTCGAAGCGTTTCCTAC
rJMSF037E04+ CAGGTCTGTGCCCCTCTTTCATTTCTACAAGAACGGAGTGCTACTCGAAGCGTTTCCTAC
                      ____________________________________________________________
consensus CAGGTCTGTGCCCCTCTTTCATTTCTACAAGAACGGAGTGCTACTCGAAGCGTTTCCTAC
 
. : . : . : . : . : . :
rJMSF002M14+ ACGTGATAAAGAGAGGATACTTTCAGCCATTCTTAAATACTCGGGTTCTTCTCCTCAAGA
rJMSF037E04+ ACGTGATAAAGAGAGGATACTTTCAGCCATTCTTAAATACTCGGGTTCTTCTCCTCAAGA
                      ____________________________________________________________
consensus ACGTGATAAAGAGAGGATACTTTCAGCCATTCTTAAATACTCGGGTTCTTCTCCTCAAGA
 
. : . : . : . : . : . :
rJMSF002M14+ TGCTTGAGTTGATGATCTGGTTTGCATTTAGACCTTTAGAAATAATAGTCCAGAATATTT
rJMSF037E04+ TGCTTGAGTTGATGATCTGGTTTGCATTTAGACCTTTAGAAATAATAGTCCAGAATATTT
                      ____________________________________________________________
consensus TGCTTGAGTTGATGATCTGGTTTGCATTTAGACCTTTAGAAATAATAGTCCAGAATATTT
 
. : . : . : . : . : . :
rJMSF002M14+ TGCCTTTGTACCTTATTATTCTTGGTGCTCAATACTAACGCTGGGCGCCCCTCCACGGTT
rJMSF037E04+ TGCCTTTGTACCTTATTATTCTTGGTGCTCAATACTAACGCTGGGCGCCCCTCCACGGTT
                      ____________________________________________________________
consensus TGCCTTTGTACCTTATTATTCTTGGTGCTCAATACTAACGCTGGGCGCCCCTCCACGGTT
 
. : . : . : . : . : . :
rJMSF002M14+ TTCGTTTCCTTGAAATTGGAATT
rJMSF037E04+ TTCGTTTCCTTGAAATTGGAATTTGTAACGTTGTACCGGCATCTATGTTTTGGAGAAATT
                      ____________________________________________________________
consensus TTCGTTTCCTTGAAATTGGAATTTGTAACGTTGTACCGGCATCTATGTTTTGGAGAAATT
 
. : . : . : . : . : . :
rJMSF037E04+ TATGTCATTTGTTCTCATGTTCTTCTGTCATGAGCATATTTTTCTCTTTGCAAAAAGTTT
                      ____________________________________________________________
consensus TATGTCATTTGTTCTCATGTTCTTCTGTCATGAGCATATTTTTCTCTTTGCAAAAAGTTT