Previous Contig 013078:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017L11Sequence499013078 (7)gb:AC011717_15373551e-45Arabidopsis thaliana chromosome 1 BAC F19K16 genomic sequence, complete sequence777013078 (7)pir|B96831|B968314e-57hypothetical protein F18B13.6 [imported] - Arabidopsis thaliana>gb:AE005173_8955
JMSF037A23Sequence686013078 (7)pir|B96831|B968313e-62hypothetical protein F18B13.6 [imported] - Arabidopsis thaliana>gb:AE005173_8955718013078 (7)pir|B96831|B968316e-46hypothetical protein F18B13.6 [imported] - Arabidopsis thaliana>gb:AE005173_8955
JMSF038A23Sequence839013078 (7)pir|B96831|B968313e-59hypothetical protein F18B13.6 [imported] - Arabidopsis thaliana>gb:AE005173_8955
JMSF048H20Sequence686013078 (7)pir|B96831|B968313e-62hypothetical protein F18B13.6 [imported] - Arabidopsis thaliana>gb:AE005173_8955709013078 (7)pir|B96831|B968311e-46hypothetical protein F18B13.6 [imported] - Arabidopsis thaliana>gb:AE005173_8955

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017L11- GGT
JMSF048H20- GGT
JMSF037A23- GGT
                      ____________________________________________________________
consensus GGT
 
. : . : . : . : . : . :
JMSF017L11- GGAAGGCTTCTAAAATTCACATTTCCATTAGCTTCTTCAATTCTCTGTTAGGGTTTCCGT
JMSF048H20- GGAAGGCTTCTAAAATTCACATTTCCATTAGCTTCTTCAATTCTCTGTTAGGGTTTCCGT
JMSF037A23- GGAAGGCTTCTAAAATTCACATTTCCATTAGCTTCTTCAATTCTCTGTTAGGGTTTCCGT
                      ____________________________________________________________
consensus GGAAGGCTTCTAAAATTCACATTTCCATTAGCTTCTTCAATTCTCTGTTAGGGTTTCCGT
 
. : . : . : . : . : . :
JMSF017L11- TTCATGTGATCTCAATTTCCAATTTCGATTCAATTTTGTGTAGAACTAGGTTTCCTAATA
JMSF048H20- TTCATGTGATCTCAATTTCCAATTTCGATTCAATTTTGTGTAGAACTAGGTTTCCTAATA
JMSF037A23- TTCATGTGATCTCAATTTCCAATTTCGATTCAATTTTGTGTAGAACTAGGTTTCCTAATA
                      ____________________________________________________________
consensus TTCATGTGATCTCAATTTCCAATTTCGATTCAATTTTGTGTAGAACTAGGTTTCCTAATA
 
. : . : . : . : . : . :
JMSF017L11- TTTAGGGGATAA-TTTTTTGAGTTGTTGAGTAGAGATGTTCTATGGA-TCGGTGGTGTGG
JMSF048H20- TTTAGGGGATAA-TTTTTTGAGTTGTTGAGTAGAGATGTTCTATGGA-TCGGTGGTGTGG
JMSF037A23- TTTAGGGGATAA-TTTTTTGAGTTGTTGAGTAGAGATGTTCTATGGA-TCGGTGGTGTGG
rJMSF017L11+ TGTGG
rJMSF038A23+ TTAGGGGATAATTTTTTTGAGTTGTTGAGTAGAGATGTTCTATGGATTCGGTGGTGTGG
                      ____________________________________________________________
consensus TTTAGGGGATAA-TTTTTTGAGTTGTTGAGTAGAGATGTTCTATGGA-TCGGTGGTGTGG
 
. : . : . : . : . : . :
JMSF017L11- GATCCTTGGCTCATTGTTGCACAAATCGTGTGCCTTCAGTGCCTCTACTACTTGATTCTG
JMSF048H20- GATCCTTGGCTCATTGTTGCACAAATCGTGTGCCTTCAGTGCCTCTACTACTTGATTCTG
JMSF037A23- GATCCTTGGCTCATTGTTGCACAAATCGTGTGCCTTCAGTGCCTCTACTACTTGATTCTG
rJMSF048H20+ TG
rJMSF017L11+ GATNCNTGGCTCATTGNTGCACAAATCGTGTGCCTTCAGTGCCTCTACTACTTGATTCTG
rJMSF038A23+ GATCCTTGGCTCATTGTTGCACAAATCGTGTGCCTTCAGTGCCTCTACTACTTGATTCTG
                      ____________________________________________________________
consensus GATCCTTGGCTCATTGTTGCACAAATCGTGTGCCTTCAGTGCCTCTACTACTTGATTCTG
 
. : . : . : . : . : . :
JMSF017L11- GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
JMSF048H20- GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
JMSF037A23- GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
rJMSF048H20+ GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
rJMSF017L11+ GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
rJMSF038A23+ GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
rJMSF037A23+ GATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
                      ____________________________________________________________
consensus GGGATATTCATGGGCGTTCTAGTCGGAACTCGAGTCTCCCGAATGAGCCTTGTTTATTTC
 
. : . : . : . : . : . :
JMSF017L11- TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
JMSF048H20- TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
JMSF037A23- TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
rJMSF048H20+ TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
rJMSF017L11+ TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
rJMSF038A23+ TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
rJMSF037A23+ TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
                      ____________________________________________________________
consensus TTTGATTACGCCAGTATTACTGCCGCCACTGTCACCGGGTGGTGTGTCATTGCTTCGTTT
 
. : . : . : . : . : . :
JMSF017L11- ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
JMSF048H20- ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
JMSF037A23- ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
rJMSF048H20+ ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
rJMSF017L11+ ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
rJMSF038A23+ ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
rJMSF037A23+ ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
                      ____________________________________________________________
consensus ATTCTAAGCTCAATTGTGGGGGCTGGCTTCTTAGTCTATCTGATTGAGAGAGCAAAGAAG
 
. : . : . : . : . : . :
JMSF017L11- TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
JMSF048H20- TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
JMSF037A23- TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
rJMSF048H20+ TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
rJMSF017L11+ TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
rJMSF038A23+ TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
rJMSF037A23+ TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
                      ____________________________________________________________
consensus TGCTTGGATTTTTCTGCCACCTTATACATCCTTCATCTTTTTATATGCATTGTGTATGGA
 
. : . : . : . : . : . :
JMSF017L11- GGTTGGCCTTCCTCATTA
JMSF048H20- GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
JMSF037A23- GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
rJMSF048H20+ GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
rJMSF017L11+ GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
rJMSF038A23+ GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
rJMSF037A23+ GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
                      ____________________________________________________________
consensus GGTTGGCCTTCCTCATTAGCATGGTGGGTTGTGAATGTTACTGGGTTTGCAATAATGGCC
 
. : . : . : . : . : . :
JMSF048H20- TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
JMSF037A23- TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
rJMSF048H20+ TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
rJMSF017L11+ TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
rJMSF038A23+ TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
rJMSF037A23+ TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
                      ____________________________________________________________
consensus TTGTTAGGTGAATACCTGTGCATAAAGCGTGAATTGCGAGAAATTCCAATAGCAAGATAC
 
. : . : . : . : . : . :
JMSF048H20- CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
JMSF037A23- CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
rJMSF048H20+ CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
rJMSF017L11+ CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
rJMSF038A23+ CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
rJMSF037A23+ CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
                      ____________________________________________________________
consensus CGTCCAAATGTTTGATTCCATAGGTGTTGACTCACAGGCAATGAACAAATTACGTGTTTA
 
. : . : . : . : . : . :
JMSF048H20- GTTTGTGCTGGCAGCTTTTGTTTCC
JMSF037A23- GTTTGTGCTGGCAGCTTTTGTTTCC
rJMSF048H20+ GTTTGTGCTGGCAGCTTTTGTTTCCAATGGAGATGATCCTGCATGAAGCTTGTGAAATGT
rJMSF017L11+ GTTTGTGCTGGCAGCTTTTGTTTCCAATGGAGATGATCCTGCATGAAGCTTGTGAAATGT
rJMSF038A23+ GTTTGTGCTGGCAGCTTTTGTTTCCAATGGAGATGATCCTGCATGAAGCTTGTGAAATGT
rJMSF037A23+ GTTTGTGCTGGCAGCTTTTGTTTCCAATGGAGATGATCCTGCATGAAGCTTGTGAAATGT
                      ____________________________________________________________
consensus GTTTGTGCTGGCAGCTTTTGTTTCCAATGGAGATGATCCTGCATGAAGCTTGTGAAATGT
 
. : . : . : . : . : . :
rJMSF048H20+ TTTGCAGCTTTTGTACATGATATGTTTTCCACACTGGAAGGCTGTGTCAAAGCATAACAC
rJMSF017L11+ TTTGCAGCTTTTGTACATGATATGTTTTCCACACTGGAAGGCTGTGTCAAAGCATAACAC
rJMSF038A23+ TTTGCAGCTTTTGTACATGATATGTTTTCCACACTGGAAGGCTGTGTCAAAGCATAACAC
rJMSF037A23+ TTTGCAGCTTTTGTACATGATATGTTTTCCACACTGGAAGGCTGTGTCAAAGCATAACAC
                      ____________________________________________________________
consensus TTTGCAGCTTTTGTACATGATATGTTTTCCACACTGGAAGGCTGTGTCAAAGCATAACAC
 
. : . : . : . : . : . :
rJMSF048H20+ ACACACTTGGTTAAAGACAAGGAAAAAGAAAGTGCGTGACGAAGTAGAACTTAGACATTT
rJMSF017L11+ ACACACTTGGTTAAAGACAAGGAAAAAGAAAGTGCGTGACGAAGTAGAACTTAGACATTT
rJMSF038A23+ ACACACTTGGTTAAAGACAAGGAAAAAGAAAGTGCGTGACGAAGTAGAACTTAGACATTT
rJMSF037A23+ ACACACTTGGTTAAAGACAAGGAAAAAGAAAGTGCGTGACGAAGTAGAACTTAGACATTT
                      ____________________________________________________________
consensus ACACACTTGGTTAAAGACAAGGAAAAAGAAAGTGCGTGACGAAGTAGAACTTAGACATTT
 
. : . : . : . : . : . :
rJMSF048H20+ GATGAATACAGTTAGAGAATGTTGGGAAAGGGTGGATAGATTTCAAGTACTTAACGATTT
rJMSF017L11+ GATGAATACAGTTAGAGAATGTTGGGAAAGGGTGGATAGATTTCAAGTACTTAACGATTT
rJMSF038A23+ GATGAATACAGTTAGAGAATGTTGGGAAAGGGTGGATAGATTTCAAGTACTTAACGATTT
rJMSF037A23+ GATGAATACAGTTAGAGAATGTTGGGAAAGGGTGGATAGATTTCAAGTACTTAACGATTT
                      ____________________________________________________________
consensus GATGAATACAGTTAGAGAATGTTGGGAAAGGGTGGATAGATTTCAAGTACTTAACGATTT
 
. : . : . : . : . : . :
rJMSF048H20+ TTTTGATGCCTTGCTGCAAGTTGGAGTTATGTGTTGTAAACTCAAAT
rJMSF017L11+ TTTTGATGCCTTGCTGCAAGTTGGAGTTATGTGTTGTAAACTCAAAT
rJMSF038A23+ TTTTGATGCCTTGCTGCAAGTTGGAGTTATGTGTTGTAAACTCAAATTGGCAATTGCCCT
rJMSF037A23+ TTTTGATGCCTTGCTGCAAGTTGGAGTTATGTGTTGTAAACTCAAATTGGCAATTGCCCT
                      ____________________________________________________________
consensus TTTTGATGCCTTGCTGCAAGTTGGAGTTATGTGTTGTAAACTCAAATTGGCAATTGCCCT