Previous Contig 013075:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037A05Sequence662013075 (2)gb:AY088353_15733733e-87Arabidopsis thaliana clone 6052 mRNA, complete sequence.714013075 (2)gb:AY088353_15733734e-72Arabidopsis thaliana clone 6052 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037A05- GGCAATTGCT
                      ____________________________________________________________
consensus GGCAATTGCT
 
. : . : . : . : . : . :
JMSF037A05- TTTTCTTTCCACAGGTTTATTCAGACAGTGCTAACTGCCAAACATTTTCTCCACCGGAAA
                      ____________________________________________________________
consensus TTTTCTTTCCACAGGTTTATTCAGACAGTGCTAACTGCCAAACATTTTCTCCACCGGAAA
 
. : . : . : . : . : . :
JMSF037A05- ATCAAGAAAACCCAATCGATGGGTCAATCTTTGCTGGAGGCGCTAAACGTGCGAGTCGTC
                      ____________________________________________________________
consensus ATCAAGAAAACCCAATCGATGGGTCAATCTTTGCTGGAGGCGCTAAACGTGCGAGTCGTC
 
. : . : . : . : . : . :
JMSF037A05- GGCTCCGGCGAGAAAACCCTGGTTCTAGCCCACGGCTCCGGCACCGACCAGTCGGCGTGG
                      ____________________________________________________________
consensus GGCTCCGGCGAGAAAACCCTGGTTCTAGCCCACGGCTCCGGCACCGACCAGTCGGCGTGG
 
. : . : . : . : . : . :
JMSF037A05- CGGGGCATTCTCCCCTATTTCCTCCGCGACTACCGCGTTGTCCTCTTCGACCTCGTCTGC
                      ____________________________________________________________
consensus CGGGGCATTCTCCCCTATTTCCTCCGCGACTACCGCGTTGTCCTCTTCGACCTCGTCTGC
 
. : . : . : . : . : . :
JMSF037A05- GCCGGCAGCGTCAACCCCGACTACTTCGACTTCCGCCGCTACACCACCCTCGACGCCTAC
                      ____________________________________________________________
consensus GCCGGCAGCGTCAACCCCGACTACTTCGACTTCCGCCGCTACACCACCCTCGACGCCTAC
 
. : . : . : . : . : . :
JMSF037A05- GCCGACGATCTCCTCAACATCCTCACCGCCCTCGGAATCGACCGCTGCTACTACGTCGGC
                      ____________________________________________________________
consensus GCCGACGATCTCCTCAACATCCTCACCGCCCTCGGAATCGACCGCTGCTACTACGTCGGC
 
. : . : . : . : . : . :
JMSF037A05- CACTCCGTCTCCGCCATGATCGGAATCCTCGCCGCCATTCGCCGCCCCGATCTCTTCTCC
rJMSF037A05+ GTCTCCGCCATGATCGGAATCCTCGCCGCCATTCGCCGCCCCGATCTCTTCTCC
                      ____________________________________________________________
consensus CACTCCGTCTCCGCCATGATCGGAATCCTCGCCGCCATTCGCCGCCCCGATCTCTTCTCC
 
. : . : . : . : . : . :
JMSF037A05- AAGCTCATCCTCATCGGCGCTTCCCCTAGGTTCTTGAATGATGAAGAGTACCATGGGGGA
rJMSF037A05+ AAGCTCATCNTCATCGGCGCTTCCCCTAGGTTCTTGAATGATGAAGAGTACCATGGGGGA
                      ____________________________________________________________
consensus AAGCTCATCCTCATCGGCGCTTCCCCTAGGTTCTTGAATGATGAAGAGTACCATGGGGGA
 
. : . : . : . : . : . :
JMSF037A05- TTCGAGCAAGGGGAGATCGAGAAAGTGTTCTCGGCAATGCAAGCGAACTACGAGGCGTGG
rJMSF037A05+ TTCGAGCAAGGGGAGATCGAGAAAGTGTTCTCGGCAATGCAAGCGAACTACGAGGCGTGG
                      ____________________________________________________________
consensus TTCGAGCAAGGGGAGATCGAGAAAGTGTTCTCGGCAATGCAAGCGAACTACGAGGCGTGG
 
. : . : . : . : . : . :
JMSF037A05- GTGCGGGGGTTTGCGCCGCTGGCGGTGGGGGCGGACGTGCCGGCGGCGGTGCGGGAGTTC
rJMSF037A05+ GTGCGGGGGTTTGCGCCGCTGGCGGTGGGGGCGGACGTGCCGGCGGCGGTGCGGGAGTTC
                      ____________________________________________________________
consensus GTGCGGGGGTTTGCGCCGCTGGCGGTGGGGGCGGACGTGCCGGCGGCGGTGCGGGAGTTC
 
. : . : . : . : . : . :
JMSF037A05- AGCCGGACGCTGTTCAACATGCGGCCGGACATAACGCTGTTCGTGTCCCGGA
rJMSF037A05+ AGCCGGACGCTGTTCAACATGCGGCCGGACATAACGCTGTTCGTGTCCCGGACGGTGTTC
                      ____________________________________________________________
consensus AGCCGGACGCTGTTCAACATGCGGCCGGACATAACGCTGTTCGTGTCCCGGACGGTGTTC
 
. : . : . : . : . : . :
rJMSF037A05+ AACAGCGACCTGAGAGGGGTGTTGGGGCTGGTGAAGGTGCCGTGCCACATCATCCAGACG
                      ____________________________________________________________
consensus AACAGCGACCTGAGAGGGGTGTTGGGGCTGGTGAAGGTGCCGTGCCACATCATCCAGACG
 
. : . : . : . : . : . :
rJMSF037A05+ GCCAAGGACGTGTCGGTGCCGGGGTCGGTGGCGACGTACCTCAAGAACCACCTCGGCGGC
                      ____________________________________________________________
consensus GCCAAGGACGTGTCGGTGCCGGGGTCGGTGGCGACGTACCTCAAGAACCACCTCGGCGGC
 
. : . : . : . : . : . :
rJMSF037A05+ CGGAACACCGTGCACGTGCTGCCCATTGAGGGCCACTTGCCTCACCTCTCCGCGCCGGCG
                      ____________________________________________________________
consensus CGGAACACCGTGCACGTGCTGCCCATTGAGGGCCACTTGCCTCACCTCTCCGCGCCGGCG
 
. : . : . : . : . : . :
rJMSF037A05+ ATGCTGGCGCAGGAGCTCCGGCGGGCTCTGGGCCGGTGAGGTGATGCCCGGCCCATGGGC
                      ____________________________________________________________
consensus ATGCTGGCGCAGGAGCTCCGGCGGGCTCTGGGCCGGTGAGGTGATGCCCGGCCCATGGGC
 
. : . : . : . : . : . :
rJMSF037A05+ CTTGGCCCGTTTTATTCTGGGGTCTTCTCCTTTGTTGTCTTATGTACTAACTATATGTGG
                      ____________________________________________________________
consensus CTTGGCCCGTTTTATTCTGGGGTCTTCTCCTTTGTTGTCTTATGTACTAACTATATGTGG
 
. : . : . : . : . : . :
rJMSF037A05+ AATAATGGGAGGTTGGGAGATAATGACATGTTGCGATTTTAACTTATGGACAAGAGTGAG
                      ____________________________________________________________
consensus AATAATGGGAGGTTGGGAGATAATGACATGTTGCGATTTTAACTTATGGACAAGAGTGAG
 
. : . : . : . : . : . :
rJMSF037A05+ TTTGCATTTAATATTTGAAAAATTTTACATTTTTGTCCTTTCGTTATATTCATAGTACAT
                      ____________________________________________________________
consensus TTTGCATTTAATATTTGAAAAATTTTACATTTTTGTCCTTTCGTTATATTCATAGTACAT