Previous Contig 013074:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037A01Sequence665013074 (2)gb:AB071202_15227299e-12Daucus carota transposon TdcA1-ORF1-ORF2 gene, partial cds.717013074 (2)gb:AB071202_15227291e-11Daucus carota transposon TdcA1-ORF1-ORF2 gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037A01- GAGAACGACCATCGCAGAACGCCAGTCCTACTCCGT
                      ____________________________________________________________
consensus GAGAACGACCATCGCAGAACGCCAGTCCTACTCCGT
 
. : . : . : . : . : . :
JMSF037A01- CGCCGTCGCTGTCGCAGCAGAGCTCCGTTGCCATCCGTGACTGCCTCATCCGTCTGGTAA
                      ____________________________________________________________
consensus CGCCGTCGCTGTCGCAGCAGAGCTCCGTTGCCATCCGTGACTGCCTCATCCGTCTGGTAA
 
. : . : . : . : . : . :
JMSF037A01- TTCATCTCAGAGAGTTGATTTCTGATTAA-GGGTAAAAAGAAAGAAAAGCTAAGGTGCTA
rJMSF037A01+ ATCTCAGAGAGTTGATTTCTGATTAAGGGGTAAAAAGAAAGAAAAGCTAAGGTGCTA
                      ____________________________________________________________
consensus TTCATCTCAGAGAGTTGATTTCTGATTAAGGGGTAAAAAGAAAGAAAAGCTAAGGTGCTA
 
. : . : . : . : . : . :
JMSF037A01- TGGAGGAGCTGAGGAATTGAAGCCGACTGTCCCAAATTAAAGCCTCTAAAGGAAGGACAA
rJMSF037A01+ TGGAGGAGCTGAGGAATTGAAGCCGACTGTCCCAAATTAAAGCCTCTAAAGGAAGGACAA
                      ____________________________________________________________
consensus TGGAGGAGCTGAGGAATTGAAGCCGACTGTCCCAAATTAAAGCCTCTAAAGGAAGGACAA
 
. : . : . : . : . : . :
JMSF037A01- TTAGGTCATTGTCCATCGTATTATGAACTGTTCAGGTATACACATACCAAACAACACGAT
rJMSF037A01+ TTAGGTCATTGTCCATCGTATTATGAACTGTTCAGGTATACACATACCAAACAACACGAT
                      ____________________________________________________________
consensus TTAGGTCATTGTCCATCGTATTATGAACTGTTCAGGTATACACATACCAAACAACACGAT
 
. : . : . : . : . : . :
JMSF037A01- GGGCAAACATTCATAGTTGAAAAAGCCAAACAAATTCATGAACAAGTTGAATCGCAACGG
rJMSF037A01+ GGGCAAACATTCATAGTTGAAAAAGCCAAACAAATTCATGAACAAGTTGAATCGCAACGG
                      ____________________________________________________________
consensus GGGCAAACATTCATAGTTGAAAAAGCCAAACAAATTCATGAACAAGTTGAATCGCAACGG
 
. : . : . : . : . : . :
JMSF037A01- GAGATGTTGCAAGAAAATGGGGAGCAGGTGGATGACAATCAATTATACTATGACGCGGTT
rJMSF037A01+ GAGATGTTGCAAGAAAATGGGGAGCAGGTGGATGACAATCAATTATACTATGACGCGGTT
                      ____________________________________________________________
consensus GAGATGTTGCAAGAAAATGGGGAGCAGGTGGATGACAATCAATTATACTATGACGCGGTT
 
. : . : . : . : . : . :
JMSF037A01- GGTGGACACGATAAGAAAAGAAGAGTTTATGGACTTGGTTCATATGGTTGTTCTGTTGTT
rJMSF037A01+ GGTGGACACGATAAGAAAAGAAGAGTTTATGGACTTGGTTCATATGGTTGTTCTGTTGTT
                      ____________________________________________________________
consensus GGTGGACACGATAAGAAAAGAAGAGTTTATGGACTTGGTTCATATGGTTGTTCTGTTGTT
 
. : . : . : . : . : . :
JMSF037A01- CATGGTCCAACTAATGATAACACTTCTGGCAATATGACACCAACATCGCGACCACCCGAC
rJMSF037A01+ CATGGTCCAACTAATGATAACACTTCTGGCAATATGACACCAACATCGCGACCACCCGAC
                      ____________________________________________________________
consensus CATGGTCCAACTAATGATAACACTTCTGGCAATATGACACCAACATCGCGACCACCCGAC
 
. : . : . : . : . : . :
JMSF037A01- AATGCTACTTCTACTTCTGCAAATGTACAACATGAAATTCAGAGTTTGAAGGAAACTATT
rJMSF037A01+ AATGCTACTTCTACTTCTGCAAATGTACAACATGAAATTCAGAGTTTGAAGGAAACTATT
                      ____________________________________________________________
consensus AATGCTACTTCTACTTCTGCAAATGTACAACATGAAATTCAGAGTTTGAAGGAAACTATT
 
. : . : . : . : . : . :
JMSF037A01- CTCCATATGCAACAACGACTTGATGCTATTGATGGCGGGAGAGCGGGTACTTCATCATCA
rJMSF037A01+ CTCCATATGCAACAACGACTTGATGCTATTGATGGCGGGAGAGCGGGTACTTCATCATCA
                      ____________________________________________________________
consensus CTCCATATGCAACAACGACTTGATGCTATTGATGGCGGGAGAGCGGGTACTTCATCATCA
 
. : . : . : . : . : . :
JMSF037A01- CCTCCATCTCAAATCAATTGATTTTAATGG
rJMSF037A01+ CCTCCATCTCAAATCAATTGATTTTAATGGTTGTTTGTTAATGTTGTTTAGACTTGAATT
                      ____________________________________________________________
consensus CCTCCATCTCAAATCAATTGATTTTAATGGTTGTTTGTTAATGTTGTTTAGACTTGAATT
 
. : . : . : . : . : . :
rJMSF037A01+ GACTATTATATTATGTATTAAGTGTGGATTGATAATGTATTATTATGTTGTTTAGACTTG
                      ____________________________________________________________
consensus GACTATTATATTATGTATTAAGTGTGGATTGATAATGTATTATTATGTTGTTTAGACTTG
 
. : . : . : . : . : . :
rJMSF037A01+ AATTGACTATTATATTATGTATTAAGTGTGGATTGATAATGTATTATTATGTTGTTTAGA
                      ____________________________________________________________
consensus AATTGACTATTATATTATGTATTAAGTGTGGATTGATAATGTATTATTATGTTGTTTAGA