Previous Contig 013061:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005M22Sequence289007114 (2)279013061 (2)gb:AC134932_17419654e-06Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0092G21, complet
JMSF036N01Sequence636007114 (2)681013061 (2)gb:ATAC018907_15437035e-61Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036N01+ GGTAATGTTGTCCCCGACACT
                      ____________________________________________________________
consensus GGTAATGTTGTCCCCGACACT
 
. : . : . : . : . : . :
rJMSF036N01+ ATAATCATGAACTCGGGTTTGCACGACGGGGTGTACTGGCCTAGCATCCGAGCTTTCATC
                      ____________________________________________________________
consensus ATAATCATGAACTCGGGTTTGCACGACGGGGTGTACTGGCCTAGCATCCGAGCTTTCATC
 
. : . : . : . : . : . :
rJMSF036N01+ AAGGGCGCAGATTACACCGCAGCGTTTTGGTCCGAGGTGATCCAAGCGGTGAAGCAGCGG
                      ____________________________________________________________
consensus AAGGGCGCAGATTACACCGCAGCGTTTTGGTCCGAGGTGATCCAAGCGGTGAAGCAGCGG
 
. : . : . : . : . : . :
rJMSF036N01+ CATAAGGTGCCACCGAAGCTTCTATACAGAACCACGGTGACAACCGGCGGCTATGCAAGA
                      ____________________________________________________________
consensus CATAAGGTGCCACCGAAGCTTCTATACAGAACCACGGTGACAACCGGCGGCTATGCAAGA
 
. : . : . : . : . : . :
rJMSF036N01+ ACATTGGCTTACAATCCCCAGAAAATGGAGGCGTTCAACGGGGTCGTGTTGGATAAGCTG
                      ____________________________________________________________
consensus ACATTGGCTTACAATCCCCAGAAAATGGAGGCGTTCAACGGGGTCGTGTTGGATAAGCTG
 
. : . : . : . : . : . :
rJMSF036N01+ AGGGCATACGCCGCCTTGGATATGGTCATCGACGATTTCGACATGACCTATCCGTGGCAC
                      ____________________________________________________________
consensus AGGGCATACGCCGCCTTGGATATGGTCATCGACGATTTCGACATGACCTATCCGTGGCAC
 
. : . : . : . : . : . :
rJMSF005M22+ CGTGTGG
rJMSF036N01+ TACGACAATAGGTGCAACGACGGGGTCCACTATGGCCGAGCTCCCGCCAAGCTCGTGTGG
                      ____________________________________________________________
consensus TACGACAATAGGTGCAACGACGGGGTCCACTATGGCCGAGCTCCCGCCAAGCTCGTGTGG
 
. : . : . : . : . : . :
rJMSF005M22+ AGGGATGGGCAGATCGGGCACCAGTANTTCGTCGACNTCATGCTCGGGCACGTGTTGCTC
rJMSF036N01+ AGGGATGGGCAGATCGGGCACCAGTACTTCGTCGACCTCATGCTCGGGCACGTGTTGCTC
                      ____________________________________________________________
consensus AGGGATGGGCAGATCGGGCACCAGTACTTCGTCGACCTCATGCTCGGGCACGTGTTGCTC
 
. : . : . : . : . : . :
rJMSF005M22+ AACGCTCTGTGCTCGAGATGGTAACGCTCGATCTTCGAGGTGCAAGNTGACCTGACAAAA
rJMSF036N01+ AACGCTCTGTGCTCGAGATGGTAACGCTCGATCTTCGAGGTGCAAGCTGACCTGACAAAA
                      ____________________________________________________________
consensus AACGCTCTGTGCTCGAGATGGTAACGCTCGATCTTCGAGGTGCAAGCTGACCTGACAAAA
 
. : . : . : . : . : . :
rJMSF005M22+ GATTGTATGAAGCCATGAGTTTCTGCATTGATTTGAACTGTTTTATGTTCTTGATCTGTG
rJMSF036N01+ GATTGTATGAAGCCATGAGTTTCTGCATTGATTTGAACTGTTTTATGTTCTTGATCTGTG
                      ____________________________________________________________
consensus GATTGTATGAAGCCATGAGTTTCTGCATTGATTTGAACTGTTTTATGTTCTTGATCTGTG
 
. : . : . : . : . : . :
rJMSF005M22+ CAATNGTTGTCTTGTCAGTTCTCATATACCACACATTGGCAGTTGTAACTTGTAATGTAA
rJMSF036N01+ CAATTGTTGTCTTGTCAGTTCTCATATACCACACATTGGCAGTTGTAACTTGTAATGTAA
                      ____________________________________________________________
consensus CAATTGTTGTCTTGTCAGTTCTCATATACCACACATTGGCAGTTGTAACTTGTAATGTAA
 
. : . : . : . : . : . :
rJMSF005M22+ CTAGTATCATAGTGATGTAAATAGTAGGTTAG
rJMSF036N01+ CTAGTATCATAGTGATGTAAATAGTAGGTTAGTATATTATTATAGTTATGAATTTATGAT
                      ____________________________________________________________
consensus CTAGTATCATAGTGATGTAAATAGTAGGTTAGTATATTATTATAGTTATGAATTTATGAT