Previous Contig 013058:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF036L24Sequence658013058 (2)gb:AB012239_15116621e-75Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K11J9.648013058 (2)gb:BT020388_16427832e-69Arabidopsis thaliana At5g61540 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036L24- GAGTAATCTCCGGTCGGGTAGTCTGAAACTCCGGAAAGTTCACT
                      ____________________________________________________________
consensus GAGTAATCTCCGGTCGGGTAGTCTGAAACTCCGGAAAGTTCACT
 
. : . : . : . : . : . :
JMSF036L24- CACTGACACTGACTGATTTCAACGATAATGGTGACCGTCGGCAAACATCTTCCGATCACT
                      ____________________________________________________________
consensus CACTGACACTGACTGATTTCAACGATAATGGTGACCGTCGGCAAACATCTTCCGATCACT
 
. : . : . : . : . : . :
JMSF036L24- CGTCTTCTCCTCTTCACACTCCTCTGCATCTTGGCAGGTGGAAGTGAGTTGGAGAAGTCA
                      ____________________________________________________________
consensus CGTCTTCTCCTCTTCACACTCCTCTGCATCTTGGCAGGTGGAAGTGAGTTGGAGAAGTCA
 
. : . : . : . : . : . :
JMSF036L24- GAACAGTACCCTTTAGTTATAAGCACCTGGCCATTCCTGGAAGCTGTTAGAGCTGCCTGG
                      ____________________________________________________________
consensus GAACAGTACCCTTTAGTTATAAGCACCTGGCCATTCCTGGAAGCTGTTAGAGCTGCCTGG
 
. : . : . : . : . : . :
JMSF036L24- AGGGCTGCCGATAGTGGTTCATCAGCTATAGATGCAGTGGTGGAAGGTTGTTCAACTTGC
                      ____________________________________________________________
consensus AGGGCTGCCGATAGTGGTTCATCAGCTATAGATGCAGTGGTGGAAGGTTGTTCAACTTGC
 
. : . : . : . : . : . :
JMSF036L24- GAGGAATTGCGGTGTGATGGTACAGTTGGGCCTGGTGGAAGTCCAGACGAGAATGGAGAA
                      ____________________________________________________________
consensus GAGGAATTGCGGTGTGATGGTACAGTTGGGCCTGGTGGAAGTCCAGACGAGAATGGAGAA
 
. : . : . : . : . : . :
JMSF036L24- ACCACGATTGATGCTATGGTCATGAACGGGGTAACGATGGAAGTTGGAGCTGTTGCGGGT
                      ____________________________________________________________
consensus ACCACGATTGATGCTATGGTCATGAACGGGGTAACGATGGAAGTTGGAGCTGTTGCGGGT
 
. : . : . : . : . : . :
JMSF036L24- ATGAGGTATGTGAAAGATGGCATAAAAGCTGCGAGGCTGGTGATGGAGTATAGTACACAC
                      ____________________________________________________________
consensus ATGAGGTATGTGAAAGATGGCATAAAAGCTGCGAGGCTGGTGATGGAGTATAGTACACAC
 
. : . : . : . : . : . :
JMSF036L24- ACGATGCTCGTTGGGGAGAAAGCTTCGGTTTTTGCCATTTCAATGGGGCTTCCAGGTCCA
                      ____________________________________________________________
consensus ACGATGCTCGTTGGGGAGAAAGCTTCGGTTTTTGCCATTTCAATGGGGCTTCCAGGTCCA
 
. : . : . : . : . : . :
JMSF036L24- ACGAACCTAAGCTCGACAGAATCGATAGAAAAATGGACCAAATGGAAAGAAAACAATTGC
                      ____________________________________________________________
consensus ACGAACCTAAGCTCGACAGAATCGATAGAAAAATGGACCAAATGGAAAGAAAACAATTGC
 
. : . : . : . : . : . :
JMSF036L24- CAGCCTAATTTTAGGAAAAATGTCATTCCTACAGACAACTGTGGTCCTTATCGTCCAAAG
rJMSF036L24+ AGGAAAAATGTCATTCCTACAGACAACTGTGGTCCTTATCGTCCAAAG
                      ____________________________________________________________
consensus CAGCCTAATTTTAGGAAAAATGTCATTCCTACAGACAACTGTGGTCCTTATCGTCCAAAG
 
. : . : . : . : . : . :
JMSF036L24- GGCTATACCTA
rJMSF036L24+ GGCTATACCTANCAGGACGAGACAAAATGTTCGGTTGGACCTAATGGATCGGGATCGTTT
                      ____________________________________________________________
consensus GGCTATACCTANCAGGACGAGACAAAATGTTCGGTTGGACCTAATGGATCGGGATCGTTT
 
. : . : . : . : . : . :
rJMSF036L24+ CATATAGGTCCTAACAACCATGACACGATATCTATGGCTGTTGTTGATAAAAAAGGACAA
                      ____________________________________________________________
consensus CATATAGGTCCTAACAACCATGACACGATATCTATGGCTGTTGTTGATAAAAAAGGACAA
 
. : . : . : . : . : . :
rJMSF036L24+ ATTGCAGCTGGCACCTCTACCAATGGGGCAACATTTAAGATTCCTGGGAGGGTTGGCGAT
                      ____________________________________________________________
consensus ATTGCAGCTGGCACCTCTACCAATGGGGCAACATTTAAGATTCCTGGGAGGGTTGGCGAT
 
. : . : . : . : . : . :
rJMSF036L24+ GGACCTATCCCTGGGTCTTCCGCATATGCCATTTCTGAAGTCGGAGCTTGTGGTGCAACC
                      ____________________________________________________________
consensus GGACCTATCCCTGGGTCTTCCGCATATGCCATTTCTGAAGTCGGAGCTTGTGGTGCAACC
 
. : . : . : . : . : . :
rJMSF036L24+ GGGGATGGTGACATCATGATGCGCTTCCTTCCATGCTATCAAGTGGTTGAGAGCATGAGG
                      ____________________________________________________________
consensus GGGGATGGTGACATCATGATGCGCTTCCTTCCATGCTATCAAGTGGTTGAGAGCATGAGG
 
. : . : . : . : . : . :
rJMSF036L24+ CTAGGCCTGGAACCGAGAGCTGCTGCTCAGGATGCAATTTCGCGAATAGCAAGGAAATAC
                      ____________________________________________________________
consensus CTAGGCCTGGAACCGAGAGCTGCTGCTCAGGATGCAATTTCGCGAATAGCAAGGAAATAC
 
. : . : . : . : . : . :
rJMSF036L24+ CCGGACTTCACTGGGGCCATTTTCGCTGTCAACAAGAGCGGCCATCATGCGGGCGCGTGC
                      ____________________________________________________________
consensus CCGGACTTCACTGGGGCCATTTTCGCTGTCAACAAGAGCGGCCATCATGCGGGCGCGTGC
 
. : . : . : . : . : . :
rJMSF036L24+ TATGGATGGACATTTCAGTACTCGGTTATGAAACCTGGGATGAACGACGTCGAGGTTTTC
                      ____________________________________________________________
consensus TATGGATGGACATTTCAGTACTCGGTTATGAAACCTGGGATGAACGACGTCGAGGTTTTC
 
. : . : . : . : . : . :
rJMSF036L24+ ACTGTTCTCCCGGAAACCAGGTCTGTTCGATGAAGATCGATGCTTCATGTATCCTTAACA
                      ____________________________________________________________
consensus ACTGTTCTCCCGGAAACCAGGTCTGTTCGATGAAGATCGATGCTTCATGTATCCTTAACA
 
. : . : . : . : . : . :
rJMSF036L24+ TGGTGTATATGTCTGTGAAGTCTACTGCAAATCAAAGTATAGAACAAATGTGATGAACAT
                      ____________________________________________________________
consensus TGGTGTATATGTCTGTGAAGTCTACTGCAAATCAAAGTATAGAACAAATGTGATGAACAT