Previous Contig 013057:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035G07Sequence676007020 (3)sp|P37830|G6PD_SOLTU3e-96Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p771013057 (3)sp|P37830|G6PD_SOLTUe-105Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p
JMSF036L23Sequence705007020 (3)sp|P37830|G6PD_SOLTU3e-97Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p698013057 (3)sp|P37830|G6PD_SOLTU5e-93Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p
JMSF042L05Sequence706007020 (3)sp|P37830|G6PD_SOLTUe-103Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p827013057 (3)gb:NTTCG9_1691794e-113Nicotiana tabacum mRNA for cytosolic glucose-6-phosphate dehydrogenase TCG9.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042L05+ TGAGCACATACGAGATGAGAAAAGTGAAGGTTCTTCAATCGGTGGTTCCCAT
                      ____________________________________________________________
consensus TGAGCACATACGAGATGAGAAAAGTGAAGGTTCTTCAATCGGTGGTTCCCAT
 
. : . : . : . : . : . :
rJMSF042L05+ TAAAGATGAAGAGGTTATTCTTGGACAATATGAAGGCTATAGGGATGATCCCACTGTTCC
rJMSF035G07+ TTGGACAATATGAAGGCTATAGGGATGATCCCACTGTTCC
                      ____________________________________________________________
consensus TAAAGATGAAGAGGTTATTCTTGGACAATATGAAGGCTATAGGGATGATCCCACTGTTCC
 
. : . : . : . : . : . :
rJMSF042L05+ CGACAACTCAAACACTCCAACTTTTGCGACCATGGTTCTGCGCATACACAATGAACGATG
rJMSF035G07+ CGACAACTCAAACACTCCAACTTTTGCGACCATGGTTCTGCGCATACACAATGAACGATG
rJMSF036L23+ CACAATGAACGATG
                      ____________________________________________________________
consensus CGACAACTCAAACACTCCAACTTTTGCGACCATGGTTCTGCGCATACACAATGAACGATG
 
. : . : . : . : . : . :
rJMSF042L05+ GGAAGGTGTGCCCTTTATACTTAAGGCAGGAAAAGCACTTAGTTCAAGAAAAGCAGAAAT
rJMSF035G07+ GGAAGGTGTGCCCTTTATACTTAAGGCAGGAAAAGCACTTAGTTCAAGAAAAGCAGAAAT
rJMSF036L23+ GGAAGGTGTGCCCTTTATACTTAAGGCAGGAAAAGCACTTAGTTCAAGAAAAGCAGAAAT
                      ____________________________________________________________
consensus GGAAGGTGTGCCCTTTATACTTAAGGCAGGAAAAGCACTTAGTTCAAGAAAAGCAGAAAT
 
. : . : . : . : . : . :
rJMSF042L05+ TCGGGTCCAATTTAAGGATGTCCCCGGTGATATATTCAAATGTCAAAAGCGTGGGAGGAA
rJMSF035G07+ TCGGGTCCAATTTAAGGATGTCCCCGGTGATATATTCAAATGTCAAAAGCGTGGGAGGAA
rJMSF036L23+ TCGGGTCCAATTTAAGGATGTCCCCGGTGATATATTCAAATGTCAAAAGCGTGGGAGGAA
                      ____________________________________________________________
consensus TCGGGTCCAATTTAAGGATGTCCCCGGTGATATATTCAAATGTCAAAAGCGTGGGAGGAA
 
. : . : . : . : . : . :
rJMSF042L05+ TGAATTTGTCATACGCCTCCAACCATCAGAAGCGATGTATATGAAACTCATGGTCAAGCA
rJMSF035G07+ TGAATTTGTCATACGCCTCCAACCATCAGAAGCGATGTATATGAAACTCATGGTCAAGCA
rJMSF036L23+ TGAATTTGTCATACGCCTCCAACCATCAGAAGCGATGTATATGAAACTCATGGTCAAGCA
                      ____________________________________________________________
consensus TGAATTTGTCATACGCCTCCAACCATCAGAAGCGATGTATATGAAACTCATGGTCAAGCA
 
. : . : . : . : . : . :
rJMSF042L05+ ACCTGGGCTAGAAATGTCGACTGCCCAGAGCGAACTAGACTTGTCATATAGGCAACGATA
rJMSF035G07+ ACCTGGGCTAGAAATGTCGACTGCCCAGAGCGAACTAGACTTGTCATATAGGCAACGATA
rJMSF036L23+ ACCTGGGCTAGAAATGTCGACTGCCCAGAGCGAACTAGACTTGTCATATAGGCAACGATA
                      ____________________________________________________________
consensus ACCTGGGCTAGAAATGTCGACTGCCCAGAGCGAACTAGACTTGTCATATAGGCAACGATA
 
. : . : . : . : . : . :
rJMSF042L05+ TCAAGGGGTTACCATTCCAGAGGCATATGAGCGTCTAATTCTTGACACAATACGAGGGGA
rJMSF035G07+ TCAAGGGGTTACCATTCCAGAGGCATATGAGCGTCTAATTCTTGACACAATACGAGGGGA
rJMSF036L23+ TCAAGGGGTTACCATTCCAGAGGCATATGAGCGTCTAATTCTTGACACAATACGAGGGGA
                      ____________________________________________________________
consensus TCAAGGGGTTACCATTCCAGAGGCATATGAGCGTCTAATTCTTGACACAATACGAGGGGA
 
. : . : . : . : . : . :
rJMSF042L05+ TCAGCAGCACTTTGTTCGCAGGGATGAGTTGAAGGTGGCTTGGGAAATCTTCACCCCGCT
rJMSF035G07+ TCAGCAGCACTTTGTTCGCAGGGATGAGTTGAAGGTGGCTTGGGAAATCTTCACCCCGCT
rJMSF036L23+ TCAGCAGCACTTTGTTCGCAGGGATGAGTTGAAGGTGGCTTGGGAAATCTTCACCCCGCT
                      ____________________________________________________________
consensus TCAGCAGCACTTTGTTCGCAGGGATGAGTTGAAGGTGGCTTGGGAAATCTTCACCCCGCT
 
. : . : . : . : . : . :
rJMSF042L05+ CCTGCACAGGATAGACGATGGAGAGTTGAAGCCGATCCCTTACAAGCCAGGCAGCCGAGG
rJMSF035G07+ CCTGCACAGGATAGACGATGGAGAGTTGAAGCCGATCCCTTACAAGCCAGGCAGCCGAGG
rJMSF036L23+ CCTGCACAGGATAGACGATGGAGAGTTGAAGCCGATCCCTTACAAGCCAGGCAGCCGAGG
                      ____________________________________________________________
consensus CCTGCACAGGATAGACGATGGAGAGTTGAAGCCGATCCCTTACAAGCCAGGCAGCCGAGG
 
. : . : . : . : . : . :
rJMSF042L05+ GCCTGTAGAAGCAGATGAGTTGTTGCGAAAGGCGGGCTATGTTCAGACCCATGGCTACAT
rJMSF035G07+ GCCTGTAGAAGCAGATGAGTTGTTGCGAAAGGCGGGCTATGTTCAGACCCATGGCTACAT
rJMSF036L23+ GCCTGTAGAAGCAGATGAGTTGTTGCGAAAGGCGGGCTATGTTCAGACCCATGGCTACAT
                      ____________________________________________________________
consensus GCCTGTAGAAGCAGATGAGTTGTTGCGAAAGGCGGGCTATGTTCAGACCCATGGCTACAT
 
. : . : . : . : . : . :
rJMSF042L05+ TTGGATCCCTCCAACCTTATA
rJMSF035G07+ TTGGATCCCTCCAACCTTATA
rJMSF036L23+ TTGGATCCCTCCAACCTTATAGAATTCCAGTTCTAGTATTAATTAAACACAACACACTTT
                      ____________________________________________________________
consensus TTGGATCCCTCCAACCTTATAGAATTCCAGTTCTAGTATTAATTAAACACAACACACTTT
 
. : . : . : . : . : . :
rJMSF036L23+ ATAATAGTTTCTGCTACAAGCCAACAATCTTCTATATGTAATATGTGGCTGCCTACCCCT
                      ____________________________________________________________
consensus ATAATAGTTTCTGCTACAAGCCAACAATCTTCTATATGTAATATGTGGCTGCCTACCCCT
 
. : . : . : . : . : . :
rJMSF036L23+ ACCAAGTAAACAGAACAACTCTTTTTGTATCCAATGAGTAATAATAAATAAATAAGCATC
                      ____________________________________________________________
consensus ACCAAGTAAACAGAACAACTCTTTTTGTATCCAATGAGTAATAATAAATAAATAAGCATC