Previous Contig 013056:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B10Sequence539002022 (4)pir|A96555|A965552e-42unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_893077 Arabidopsis109013056 (5)gb:AJ628349_18125340.001Nicotiana suaveolens mRNA for S-adenosyl-L-methionine:benzoic acid/salicylic aci
JMSF005G05Sequence393013056 (5)gb:SFL308570_17150133e-34Stephanotis floribunda mRNA for S-adenosyl-L-methionine:salicylic acid carboxyl 457013056 (5)gb:AY233466_15916905e-29Petunia x hybrida S-adenosyl-L-methionine:benzoic acid/salicylic acid carboxyl m
JMSF036L21Sequence656013056 (5)gb:SFL308570_17150136e-68Stephanotis floribunda mRNA for S-adenosyl-L-methionine:salicylic acid carboxyl 690013056 (5)gb:AY233466_15916903e-56Petunia x hybrida S-adenosyl-L-methionine:benzoic acid/salicylic acid carboxyl m

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005G05- GACGGAGT
JMSF036L21- GACGGAGT
                      ____________________________________________________________
consensus GACGGAGT
 
. : . : . : . : . : . :
JMSF005G05- ATTTTATATTCCTTGAAAAGTTGAGAGAGATCAGAGATGAAGGTAGCTGAAGTGCTTCGA
JMSF036L21- ATTTTATATTCCTTGAAAAGTTGAGAGAGATCAGAGATGAAGGTAGCTGAAGTGCTTCGA
                      ____________________________________________________________
consensus ATTTTATATTCCTTGAAAAGTTGAGAGAGATCAGAGATGAAGGTAGCTGAAGTGCTTCGA
 
. : . : . : . : . : . :
JMSF005G05- ATGAATGGAGGAATTGGAGACACCAGTTATGCCAACAACTCCCTTATTCAGCAAAACGTG
JMSF036L21- ATGAATGGAGGAATTGGAGACACCAGTTATGCCAACAACTCCCTTATTCAGCAAAACGTG
                      ____________________________________________________________
consensus ATGAATGGAGGAATTGGAGACACCAGTTATGCCAACAACTCCCTTATTCAGCAAAACGTG
 
. : . : . : . : . : . :
JMSF005G05- ATACAGATAACAAAGCCCATAACAGACCAAGCCATAACAAGCCTCTACACCACCCTCATC
JMSF036L21- ATACAGATAACAAAGCCCATAACAGACCAAGCCATAACAAGCCTCTACACCACCCTCATC
                      ____________________________________________________________
consensus ATACAGATAACAAAGCCCATAACAGACCAAGCCATAACAAGCCTCTACACCACCCTCATC
 
. : . : . : . : . : . :
JMSF005G05- AACAACCCTAAGACTATCTCCATTGCAGACTTGGGGTGTTCCTCTGGCCCCAACACTTTG
JMSF036L21- AACAACCCTAAGACTATCTCCATTGCAGACTTGGGGTGTTCCTCTGGCCCCAACACTTTG
                      ____________________________________________________________
consensus AACAACCCTAAGACTATCTCCATTGCAGACTTGGGGTGTTCCTCTGGCCCCAACACTTTG
 
. : . : . : . : . : . :
JMSF005G05- CTCACAGTCTCTAACCTCATGAAAGCCGTCGACAACCACCGGAAGAAGCTCCGGCGGCAA
JMSF036L21- CTCACAGTCTCTAACCTCATGAAAGCCGTCGACAACCACCGGAAGAAGCTCCGGCGGCAA
                      ____________________________________________________________
consensus CTCACAGTCTCTAACCTCATGAAAGCCGTCGACAACCACCGGAAGAAGCTCCGGCGGCAA
 
. : . : . : . : . : . :
JMSF005G05- CACTCACCGGAGTTCCAGATTTACTTAAATGACCTTCCCACCAACGACTTCAACACCATT
JMSF036L21- CACTCACCGGAGTTCCAGATTTACTTAAATGACCTTCCCACCAACGACTTCAACACCATT
                      ____________________________________________________________
consensus CACTCACCGGAGTTCCAGATTTACTTAAATGACCTTCCCACCAACGACTTCAACACCATT
 
. : . : . : . : . : . :
JMSF005G05- TTCCAGTCGTTGCCNAAACATAGGA
JMSF036L21- TTCCAGTCGTTGCCAAAACATAGGAGGGAGATAGCAGGAGACGGGTCTGGGCTGTGTTTC
                      ____________________________________________________________
consensus TTCCAGTCGTTGCCAAAACATAGGAGGGAGATAGCAGGAGACGGGTCTGGGCTGTGTTTC
 
. : . : . : . : . : . :
JMSF036L21- TTCAATGGAGTTCCTGGTTCATTTTATGGAAGGCTTTTCCCCACCGATAGCCTCCATTTT
                      ____________________________________________________________
consensus TTCAATGGAGTTCCTGGTTCATTTTATGGAAGGCTTTTCCCCACCGATAGCCTCCATTTT
 
. : . : . : . : . : . :
JMSF036L21- GTTCATTCTTCTTATAGTCTCCATTGGCTATCTCAAGTACCTAAAGGAATAGAAGAGAAC
rJMSF036L21+ CCTAAAGGAATAGAAGAGACC
                      ____________________________________________________________
consensus GTTCATTCTTCTTATAGTCTCCATTGGCTATCTCAAGTACCTAAAGGAATAGAAGAGACC
 
. : . : . : . : . : . :
JMSF036L21- AAGGGTAACATTTCGATGGCAAGTGATAGTCCACCAACTGTGATAAAGGCATACTATGAT
rJMSF036L21+ ANGGGTAACATTTCGATGGCAAGTGATAGTCCACCAACTGTGATAAAGGCATACTATGAT
                      ____________________________________________________________
consensus AAGGGTAACATTTCGATGGCAAGTGATAGTCCACCAACTGTGATAAAGGCATACTATGAT
 
. : . : . : . : . : . :
JMSF036L21- CAATTTGAACGAGATTTTTCTACTTTTCTCAAGTGTCGTTCTATAGAA
rJMSF036L21+ CAATTTGAACGAGATTTTTCTACTTTTCTCAAGTGTCGTTCTATAGAATTGGTGAAAGGT
                      ____________________________________________________________
consensus CAATTTGAACGAGATTTTTCTACTTTTCTCAAGTGTCGTTCTATAGAATTGGTGAAAGGT
 
. : . : . : . : . : . :
rJMSF036L21+ GGGAGAATGGTTTTGACCATGTTGGGTAGACAAAGTGAAAACCCTACTTGGGATATTTGG
                      ____________________________________________________________
consensus GGGAGAATGGTTTTGACCATGTTGGGTAGACAAAGTGAAAACCCTACTTGGGATATTTGG
 
. : . : . : . : . : . :
rJMSF005G05+ CTAGGTTTAGCCCTCAATGATATAGCTGCAGAGGGTTTTGTGGAAGAAGAGAAA
rJMFF007B10+ TAGCTGCAGAGGGNTTTGNGGAAGAAGAGAAA
rJMSF036L21+ GAACTCCTAGGTTTAGCCCTCAATGATATAGCTGCAGAGGGTTTTGTGGAAGAAGAGAAA
                      ____________________________________________________________
consensus GAACTCCTAGGTTTAGCCCTCAATGATATAGCTGCAGAGGGTTTTGTGGAAGAAGAGAAA
 
. : . : . : . : . : . :
rJMSF005G05+ CTAAATTCGTTTAATTNGCCTGTATACGGACCATCTTTAGCAGAAATAAAANTGGTAATT
rJMFF007B10+ NTAAATTNGTTTNATTTGCCTGTATACGGACCATCTTTAGCAGAAATAAAATTGGTAATT
rJMSF036L21+ CTAAATTCGTTTAATTTGCCTGTATACGGACCATCTTTAGCAGAAATAAAATTGGTAATT
                      ____________________________________________________________
consensus CTAAATTCGTTTAATTTGCCTGTATACGGACCATCTTTAGCAGAAATAAAATTGGTAATT
 
. : . : . : . : . : . :
rJMSF005G05+ GAAAAGAATGGTTCCTTCACTATTGATCGCTTAGACATTTCTAGAATTCATTGGACTGGA
rJMFF007B10+ GAAAAGAATGGTTCCTT
rJMSF036L21+ GAAAAGAATGGTTCCTTCACTATTGATCGCTTAGACATTTCTAGAATTCATTGGACTGGA
                      ____________________________________________________________
consensus GAAAAGAATGGTTCCTTCACTATTGATCGCTTAGACATTTCTAGAATTCATTGGACTGGA
 
. : . : . : . : . : . :
rJMSF005G05+ AATATTGGAAGTGAGGATGAAAATATTGTTAGTGACGAGGGTAATGGTGGGTACGGTGTT
rJMSF036L21+ AATATTGGAAGTGAGGATGAAAATATTGTTAGTGACGAGGGTAATGGTGGGTACGGTGTT
                      ____________________________________________________________
consensus AATATTGGAAGTGAGGATGAAAATATTGTTAGTGACGAGGGTAATGGTGGGTACGGTGTT
 
. : . : . : . : . : . :
rJMSF005G05+ GCTAGAAGCGTAAGAGCTGTGGTTGAGCCTATGCTTGTTAGCCACTTCGGCCAATGAATA
rJMSF036L21+ GCTAGAAGCGTAAGAGCTGTGGTTGAGCCTATGCTTGTTAGCCACTTCGGCCAATGAATA
                      ____________________________________________________________
consensus GCTAGAAGCGTAAGAGCTGTGGTTGAGCCTATGCTTGTTAGCCACTTCGGCCAATGAATA
 
. : . : . : . : . : . :
rJMSF005G05+ ATTGAGGAGTNGTTTCATAGGTACAAAAAGATGATTGATGATTCCATGTCGACTCGTCCG
rJMSF036L21+ ATTGAGGAGTTGTTTCATAGGTACAAAAAGATGATTGATGATTCCATGTCGACTCGTCCG
                      ____________________________________________________________
consensus ATTGAGGAGTTGTTTCATAGGTACAAAAAGATGATTGATGATTCCATGTCGACTCGTCCG
 
. : . : . : . : . : . :
rJMSF005G05+ GAGGACACTCAATTCACTAATGCTACTGTTTCCACTANTAAAGTGTAATTTTATTCTAAA
rJMSF036L21+ GAGGACACTCAATTCACTAATGCTACTGTTTCCATTATTAAAGTGTAATTTTATTCTAAA
                      ____________________________________________________________
consensus GAGGACACTCAATTCACTAATGCTACTGTTTCCATTATTAAAGTGTAATTTTATTCTAAA
 
. : . : . : . : . : . :
rJMSF005G05+ NGTATCGCCAATTTCTANCNTAATTTGCGTGTTTAGTTAAGAT
rJMSF036L21+ TGTATCGCCAATTTCTA-CTTAATTTGTGTGTTTAGTTAAGATTTTCATGTAATATATCT
                      ____________________________________________________________
consensus TGTATCGCCAATTTCTANCTTAATTTGTGTGTTTAGTTAAGATTTTCATGTAATATATCT