Previous Contig 013055:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN033K03Sequence623013055 (8)gb:AY052303_1562676e-111Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF015H03Sequence221005548 (8)759013055 (8)gb:AY052303_1562676e-114Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF018I08Sequence245013055 (8)gb:AY052303_15626761e-38Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531 735009634 (3)gb:AY052303_15626765e-70Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF020N14Sequence451005548 (8)gb:AY052303_15626766e-68Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531 806013055 (8)gb:AY052303_15626764e-94Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF022E20Sequence707005548 (8)gb:ATH010466_15518991e-87Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.760013055 (8)gb:AY052303_15626764e-91Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF033A20Sequence707005548 (8)gb:ATH010466_15518993e-88Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.658013055 (8)gb:AY052303_15626761e-71Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF036L14Sequence682005548 (8)gb:ATH010466_15518997e-83Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.712013055 (8)gb:AY052303_15626766e-81Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF048B09Sequence709005548 (8)gb:ATH010466_15518993e-88Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.811013055 (8)gb:AY052303_1562676e-101Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018I08- GGAAGGATACTTGCATTAGCAAGAGAAAATAATCTTTCTT
                      ____________________________________________________________
consensus GGAAGGATACTTGCATTAGCAAGAGAAAATAATCTTTCTT
 
. : . : . : . : . : . :
JMSF018I08- TGAGAAATGTGAGGCATTTTATACTGGATGAATGTGATAAGATGCTTGAATCACTTGACA
                      ____________________________________________________________
consensus TGAGAAATGTGAGGCATTTTATACTGGATGAATGTGATAAGATGCTTGAATCACTTGACA
 
. : . : . : . : . : . :
JMSF018I08- TGAGGAGAGATGTCCAAGAAATTTTCAAGATGACTCCTCACGACAAGCAGGTTATGATGT
JMFN033K03- TCATGACAAACAGGTGATGATGT
rJMSF015H03+ TTTTCAAGATGACTCCTCATGACAAACAGGTGATGATGT
                      ____________________________________________________________
consensus TGAGGAGAGATGTCCAAGAAATTTTCAAGATGACTCCTCATGACAAACAGGTGATGATGT
 
. : . : . : . : . : . :
JMSF018I08- TCTCTGCAACTCTCAGCAAGGAGATCCGTCCTGTTTGCAAGAAGTTTATGCAAGATCCAA
JMFN033K03- TCTCAGCAACTCTCAGCAAGGAGATTCGTCCAGTTTGCAAGAAGTTTATGCAAGATCCAA
rJMSF015H03+ TCTCAGCAACTCTCAGCAAGGAGATTCGTCCAGTTTGCAAGAAGTTTATGCAAGATCCAA
                      ____________________________________________________________
consensus TCTCAGCAACTCTCAGCAAGGAGATTCGTCCAGTTTGCAAGAAGTTTATGCAAGATCCAA
 
. : . : . : . : . : . :
JMSF018I08- TGGAAATTTATGT
JMFN033K03- TGGAGATTTATGTTGACGATGAGGCCAAATTGACTCTTCATGGACTTGTACAGCACTACA
rJMSF015H03+ TGGAGATTTATGTTGACGATGAGGCCAAATTGACTCTTCATGGACTTGTACAGCACTACA
rJMSF020N14+ GAGATTTATGTTGACGATGAGGCCAAATTGACTCTTCATGGACTTGTACAGCACTACA
rJMSF048B09+ GAGATTTATGTTGACGATGAGGCCAAATTGACTCTTCATGGACTTGTACAGCACTACA
rJMSF022E20+ ACGATGAGGCCAAATTGACTCTTCATGGACTTGTACAGCACTACA
                      ____________________________________________________________
consensus TGGAGATTTATGTTGACGATGAGGCCAAATTGACTCTTCATGGACTTGTACAGCACTACA
 
. : . : . : . : . : . :
JMFN033K03- TCAAATTGACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
rJMSF015H03+ TCAAATTGACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
rJMSF020N14+ TCAAATTGACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
rJMSF048B09+ TCAAATTGACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
rJMSF033A20+ ATT
rJMSF022E20+ TCAAATTGACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
rJMSF036L14+ ACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
                      ____________________________________________________________
consensus TCAAATTGACAGAAATGGAGAAAAATCGGAAGCTGAACGACTTGCTTGATGCTTTGGATT
 
. : . : . : . : . : . :
JMFN033K03- TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
rJMSF015H03+ TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
rJMSF020N14+ TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
rJMSF048B09+ TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
rJMSF033A20+ TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
rJMSF022E20+ TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
rJMSF036L14+ TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
                      ____________________________________________________________
consensus TCAATCAAGTAGTTATCTTTGTCAAGAGTGTGACTAGAGCGGCTGAGCTGAACAAGTTAC
 
. : . : . : . : . : . :
JMFN033K03- TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
rJMSF015H03+ TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
rJMSF020N14+ TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
rJMSF048B09+ TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
rJMSF033A20+ TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
rJMSF022E20+ TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
rJMSF036L14+ TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
                      ____________________________________________________________
consensus TTGTTGAGTGTAACTTTCCATCTATCTGCATCCACTCTGGGATGTCCCAGGAGGAGAGAT
 
. : . : . : . : . : . :
JMFN033K03- TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
rJMSF015H03+ TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
rJMSF020N14+ TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
rJMSF048B09+ TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
rJMSF033A20+ TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
rJMSF022E20+ TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
rJMSF036L14+ TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
                      ____________________________________________________________
consensus TGACACGCTACAAGGGTTTCAAGGAGGGGCATAAGAGGATTCTTGTGGCAACTGATTTGG
 
. : . : . : . : . : . :
JMFN033K03- TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
rJMSF015H03+ TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
rJMSF020N14+ TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
rJMSF048B09+ TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
rJMSF033A20+ TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
rJMSF022E20+ TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
rJMSF036L14+ TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
                      ____________________________________________________________
consensus TTGGCAGGGGCATTGATATTGAACGGGTTAACATTGTCATTAACTATGACATGCCTGATT
 
. : . : . : . : . : . :
JMFN033K03- CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
rJMSF015H03+ CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
rJMSF020N14+ CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
rJMSF048B09+ CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
rJMSF033A20+ CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
rJMSF022E20+ CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
rJMSF036L14+ CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
                      ____________________________________________________________
consensus CTGCTGATACGTACCTTCATAGAGTTGGTAGAGCTGGAAGGTTTGGCACCAAAGGTCTTG
 
. : . : . : . : . : . :
JMFN033K03- CAATTACATTTGTTTCTTCTTCATCAAATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
rJMSF015H03+ CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
rJMSF020N14+ CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
rJMSF048B09+ CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
rJMSF033A20+ CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
rJMSF022E20+ CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
rJMSF036L14+ CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
                      ____________________________________________________________
consensus CAATTACATTTGTTTCTTCTTCATCAGATTCAGATGTACTCAACCAGGTTCAAGAAAGAT
 
. : . : . : . : . : . :
JMFN033K03- TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
rJMSF015H03+ TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
rJMSF020N14+ TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
rJMSF048B09+ TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
rJMSF033A20+ TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
rJMSF022E20+ TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
rJMSF036L14+ TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
                      ____________________________________________________________
consensus TTGAAGTCGATATCAAAGAGCTTCCTGAGCAGATTGACACATCCACATATATGCCATCCT
 
. : . : . : . : . : . :
rJMSF015H03+ AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
rJMSF020N14+ AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
rJMSF048B09+ AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
rJMSF033A20+ AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
rJMSF022E20+ AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
rJMSF036L14+ AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
                      ____________________________________________________________
consensus AGAGAAGTTGGCTGGCATCCTCTCCAATAGCGCCCCAAGGTTTTCTTGAATGATGCAGAA
 
. : . : . : . : . : . :
rJMSF015H03+ TGAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTT
rJMSF020N14+ TGAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTTTGTTGGTCTGTACTATTAAATGGT
rJMSF048B09+ ATAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTTTGTTGGTCTGTACTATTAAATGGT
rJMSF033A20+ TGAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTTTGTTGGTCTGTACTATTAAATGGT
rJMSF022E20+ TGAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTTTGTTGGTCTGTACTATTAAATGGT
rJMSF036L14+ TGAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTTTGTTGGTCTGTACTATTAAATGGT
                      ____________________________________________________________
consensus TGAAAGGGGAGCAAACTGCTGGCGTTTTTTGGCTTTTGTTGGTCTGTACTATTAAATGGT
 
. : . : . : . : . : . :
rJMSF020N14+ TGAATCAATTATTTTCAGAGATACTAGTGGCCTTTGGCAACTCTCTGCTTTAATCATCCT
rJMSF048B09+ TGAATCAATTATTTTCAGAGATACTAGTGGCCTTTGGCAACTCTCTGCTTTAATCATCCT
rJMSF033A20+ TGAATCAATTATTTTCAGAGATACTAGTGGCCTTTGGCAACTCTCTGCTTTAATCATCCT
rJMSF022E20+ TGAATCAATTATTTTCAGAGATACTAGTGGCCTTTGGCAACTCTCTGCTTTAATCATCCT
rJMSF036L14+ TGAATCAATTATTTTCAGAGATACTAGTGGCCTTTGGCAACTCTCTGCTTTAATCATCCT
                      ____________________________________________________________
consensus TGAATCAATTATTTTCAGAGATACTAGTGGCCTTTGGCAACTCTCTGCTTTAATCATCCT
 
. : . : . : . : . : . :
rJMSF020N14+ GTCATTACTGTACCCTTTAATGAAACATAGCTGGTTTAGCCGATTGTACT
rJMSF048B09+ GTCATTACTGTACCCTTTAATGAAACATAGCTGGTTTAGCCGATTGTACTAAGCT
rJMSF033A20+ GTCATTACTGTACCCTTTAATGAAACATAGCTGGTTTAGCCGATTGTACTAAGCT
rJMSF022E20+ GTCATTACTGTACCCTTTAATGAAACATAGCTGGTTTAGCCGATTGTACTAAGCT
rJMSF036L14+ GTCATTACTGTACCCTTTAATGAAACATAGCTGGTTTAGCCGATTGTACTAAGCTTGTAT
                      ____________________________________________________________
consensus GTCATTACTGTACCCTTTAATGAAACATAGCTGGTTTAGCCGATTGTACTAAGCTTGTAT