Previous Contig 013045:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF036I07Sequence575013045 (2)gb:AP005284_18498091e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B112
JMSF036J07Sequence640019901707013045 (2)gb:AP004791_18451442e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036J07+ TATCCAAACGTGGTTAGAAAGGAGACACTGTTGGAGCCTTCTGATCTTAG
                      ____________________________________________________________
consensus TATCCAAACGTGGTTAGAAAGGAGACACTGTTGGAGCCTTCTGATCTTAG
 
. : . : . : . : . : . :
rJMSF036J07+ GTTCTTTCAAAATCACTCATCCCAGATGGCAGCACTAGATTATCTTGTTTCATTGGAGAG
                      ____________________________________________________________
consensus GTTCTTTCAAAATCACTCATCCCAGATGGCAGCACTAGATTATCTTGTTTCATTGGAGAG
 
. : . : . : . : . : . :
rJMSF036I07+ TATGACGGAAACATGGCTAAAGNTGTTGAAGGACACCGCAG
rJMSF036J07+ TGATATTTTCATTCCTACGTATGACGGAAACATGGCTAAAGTTGTTGAAGGACACCGCAG
                      ____________________________________________________________
consensus TGATATTTTCATTCCTACGTATGACGGAAACATGGCTAAAGTTGTTGAAGGACACCGCAG
 
. : . : . : . : . : . :
rJMSF036I07+ ACATCTTGGGTACAGGAAGACGATCCTTCTGGACCGAAAGGTTNTGGTTGAGTTGATAGA
rJMSF036J07+ ACATCTTGGGTACAGGAAGACGATCCTTCTGGACCGAAAGGTTCTGGTTGAGTTGATAGA
                      ____________________________________________________________
consensus ACATCTTGGGTACAGGAAGACGATCCTTCTGGACCGAAAGGTTCTGGTTGAGTTGATAGA
 
. : . : . : . : . : . :
rJMSF036I07+ CCGGTNCGANGAAGGGTCATTTACATGGCATGAGTTCTNTAATGCTGTAAAGGAATCTCA
rJMSF036J07+ CCGGTACGATGAAGGGTCATTTACATGGCATGAGTTCTCTAATGCTGTAAAGGAATCTCA
                      ____________________________________________________________
consensus CCGGTACGATGAAGGGTCATTTACATGGCATGAGTTCTCTAATGCTGTAAAGGAATCTCA
 
. : . : . : . : . : . :
rJMSF036I07+ TGCTGGTCGCATGGGAAACCCAACCCGGAGGTTGGTTATCCCAGACAGACCGAAAGAAGA
rJMSF036J07+ TGCTGGTCGCATGGGAAACCCAACCCGGAGGTTGGTTATCCCAGACAGACCGAAAGAAGA
                      ____________________________________________________________
consensus TGCTGGTCGCATGGGAAACCCAACCCGGAGGTTGGTTATCCCAGACAGACCGAAAGAAGA
 
. : . : . : . : . : . :
rJMSF036I07+ GGACTATTTCTACGCCAACCCGTGGGAGTGTTTGGAGGATGTAGCAGCAAGAACTAGTTT
rJMSF036J07+ GGACTATTTCTACGCCAACCCGTGGGAGTGTTTGGAGGATGTAGCAGCAAGAACTAGTTT
                      ____________________________________________________________
consensus GGACTATTTCTACGCCAACCCGTGGGAGTGTTTGGAGGATGTAGCAGCAAGAACTAGTTT
 
. : . : . : . : . : . :
rJMSF036I07+ TTAAGTCCCCGANGGCGCTGGTGGGTTGCGCAATGTATGTATACACACACTACCACTCAC
rJMSF036J07+ TTAAGTCCCCGATGGCGCTGGTGGGTTGCGCAATGTATGTATACACACACTACCACTCAC
                      ____________________________________________________________
consensus TTAAGTCCCCGATGGCGCTGGTGGGTTGCGCAATGTATGTATACACACACTACCACTCAC
 
. : . : . : . : . : . :
rJMSF036I07+ TGCTGNTGTGCAACAGGTTTAGACAAAAGATTAGGTNTCTGGGAAAGCAGCCACCACGGG
rJMSF036J07+ TGCTGTTGTGCAACAGGTTTAGACAAAAGATTAGGTCTCTGGGAAAGCAGCCACCACGGG
                      ____________________________________________________________
consensus TGCTGTTGTGCAACAGGTTTAGACAAAAGATTAGGTCTCTGGGAAAGCAGCCACCACGGG
 
. : . : . : . : . : . :
rJMSF036I07+ TGTAGTCCAGTCGGGTGGGGGAGAGACGATCGCACTTCAAATGGTCCTGAAGCGACCCTC
rJMSF036J07+ TGTAGTCCAGTCGGGTGGGGGAGAGACGA-CGCACTTCAAATGGTCCTGAAGCGACCCTC
                      ____________________________________________________________
consensus TGTAGTCCAGTCGGGTGGGGGAGAGACGATCGCACTTCAAATGGTCCTGAAGCGACCCTC
 
. : . : . : . : . : . :
rJMSF036I07+ CCCGGCAGGCAGGCAGGCAATGCGGAGTATATTTTATTTTAATAAATCCAAAAAAAATTC
rJMSF036J07+ CCCGGCAGGCAGGCAGGCAA-GCGGAGTATATTTTATTTTAATAAATCCAAAAAAAATTC
                      ____________________________________________________________
consensus CCCGGCAGGCAGGCAGGCAATGCGGAGTATATTTTATTTTAATAAATCCAAAAAAAATTC
 
. : . : . : . : . : . :
rJMSF036I07+ AATGTATACGATGCCGCCCTNCCATTGCAGGGGGGCTATATTNACCGAACTC
rJMSF036J07+ AATGTATA-GATGCCGCCCTGCCATTGCAGGGGGGCTATATTGACCGAACTCAACGGCTG
                      ____________________________________________________________
consensus AATGTATACGATGCCGCCCTGCCATTGCAGGGGGGCTATATTGACCGAACTCAACGGCTG