Previous Contig 013040:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006A23Sequence604013040 (22)sp|P46297|RS23_FRAAN8e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto614013040 (22)sp|P46297|RS23_FRAAN8e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFF015F07Sequence611013040 (22)sp|P46297|RS23_FRAAN3e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto619013040 (22)sp|P46297|RS23_FRAAN4e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFF025I11Sequence614013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto626013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFF046D11Sequence550013040 (22)sp|P46297|RS23_FRAAN7e-7440S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto462013040 (22)gb:AF220539_17782814e-48Euphorbia esula 40s ribosomal protein S23 mRNA, complete cds.
JMFN017J01Sequence598013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFN025M20Sequence614013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFN042E13Sequence612013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFN043G24Sequence629013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMFN046L05Sequence539013040 (22)sp|P46297|RS23_FRAAN7e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMSF007P08Sequence235013040 (22)gb:AC104433_17376205e-23Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete sequence.>gb607013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMSF011P20Sequence231013040 (22)gb:AC104433_17376206e-23Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete sequence.>gb605013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMSF036H08Sequence616007094 (2)gb:AY085371_15704421e-20Arabidopsis thaliana clone 148254 mRNA, complete sequence.629013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMSF047L08Sequence652013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto597013040 (22)sp|P46297|RS23_FRAAN9e-7640S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto
JMSF050I08Sequence678013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto627013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025M20+ AGATGAATATTTTAATTAAATAGACAACAAAATTCGAGTACAGTAAATAGATAGGAAAG-
JMFN017J01+ AACAAAATTCGAGTACAGTAAATAGATAGGAAAGT
JMFN042E13+ AATTAAATAGACAACAAAATTCGAGTACAGTAAATAGATAGGAAAGT
JMFN043G24+ TTTAATTAAATAGACAACAAAATTCGAGTACAGTAAATAGATAGGAAAGT
rJMFF006A23- CAAAATTCGAGTACAGTAAATAGATAGGAAAGT
JMFF006A23+ GTACAGTAAATAGATAGGAAAGT
rJMFF025I11- ACAAAATTCGAGTACAGTAAATAGATAGGAAAGT
rJMFF015F07- AATTCGAGTACAGTAAATAGATAGGAAAGT
JMFF015F07+ TACAGTAAATAGATAGGAAAGT
rJMSF011P20- ATAGATAGGAAAGT
rJMSF047L08- AATAGATAGGAAAGT
JMFF025I11+ TACAGTAAATAGATAGGAAAGT
rJMSF050I08- ACAAAATTCGAGTACAGTAAATAGATAGGAAAGT
rJMSF007P08- ATAGATAGGAAAGT
rJMSF036H08- GTAAATAGATAGGAAAGT
                      ____________________________________________________________
consensus AGATGAATATTTTAATTAAATAGACAACAAAATTCGAGTACAGTAAATAGATAGGAAAGT
 
. : . : . : . : . : . :
JMFN025M20+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFN017J01+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFN042E13+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFN043G24+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMFF006A23- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFF006A23+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMFF025I11- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMFF015F07- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFF015F07+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMSF011P20- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMSF047L08- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFN046L05+ CAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFF025I11+ TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMSF050I08- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
rJMSF007P08- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
JMFF046D11+ TCATCAAACTA
rJMSF036H08- TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
                      ____________________________________________________________
consensus TTTAACCAAACAAAAACTCGACACAACAAAAAGTTCATCTCTATTGTTATCATCAAACTA
 
. : . : . : . : . : . :
JMFN025M20+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFN017J01+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFN042E13+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFN043G24+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMFF006A23- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFF006A23+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMFF025I11- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMFF015F07- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFF015F07+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMSF011P20- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMSF047L08- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFN046L05+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMFF046D11- CTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFF025I11+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMSF047L08+ CTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMSF050I08- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMSF007P08- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
JMFF046D11+ AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTNTTCTCCTGNAAGAG
JMSF050I08+ CTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
rJMSF036H08- AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
                      ____________________________________________________________
consensus AGATGCTCAGGAGGATTCCACAATCTAAGATCTTGGTTTCTCCTTTTTCTCCTTGAAGAG
 
. : . : . : . : . : . :
JMFN025M20+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFN017J01+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFN042E13+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFN043G24+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMFF006A23- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFF006A23+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMFF025I11- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMFF015F07- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFF015F07+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMSF011P20- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMSF047L08- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFN046L05+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMFF046D11- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFF025I11+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMSF047L08+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMSF050I08- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMSF007P08- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMFF046D11+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
JMSF050I08+ AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
rJMSF036H08- AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
                      ____________________________________________________________
consensus AGCCAGGAGAGAGACTCCAGAAACCTTCACAACCTTGAACCTAACACCGGGGATATCTCC
 
. : . : . : . : . : . :
JMFN025M20+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFN017J01+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFN042E13+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFN043G24+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMFF006A23- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFF006A23+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMFF025I11- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMFF015F07- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFF015F07+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMSF011P20- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMSF047L08- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFN046L05+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMFF046D11- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFF025I11+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMSF047L08+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMSF050I08- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMSF007P08- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMFF046D11+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
JMSF050I08+ CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
rJMSF036H08- CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
                      ____________________________________________________________
consensus CACGGCGTGACCCTTCCTACCAAATCCAGCAATCAACACCTCATCATTTTCTTCGATGTA
 
. : . : . : . : . : . :
JMFN025M20+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFN017J01+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFN042E13+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFN043G24+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMFF006A23- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFF006A23+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMFF025I11- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMFF015F07- GCTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFF015F07+ GCTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMSF011P20- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMSF047L08- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFN046L05+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMFF046D11- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFF025I11+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMSF047L08+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMSF050I08- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMSF007P08- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMFF046D11+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
JMSF050I08+ GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
rJMSF036H08- GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
                      ____________________________________________________________
consensus GTTCAAGCAACCATCATTCGGGACAAATGCAGCAATTTTCTTCCCGTTCTTGATGAGTTG
 
. : . : . : . : . : . :
JMFN025M20+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFN017J01+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFN042E13+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFN043G24+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMFF006A23- AACCCTAGCACATTTACGAATGGCAGAGTTTGCTTGTTTGGCCTCAATACCTATCTTTTC
JMFF006A23+ AACCCTAGCACATTTACGAATGGCAGAGTTTGCTTGTTTGGCCTCAATACCTATCTTTTC
rJMFF025I11- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMFF015F07- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFF015F07+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMSF011P20- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMSF047L08- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFN046L05+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMFF046D11- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFF025I11+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMSF047L08+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMSF050I08- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
rJMSF007P08- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMFF046D11+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMSF050I08+ AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
JMSF007P08+ TC
rJMSF036H08- AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
                      ____________________________________________________________
consensus AACCCTAGCACATTTACGAATGGCAGAGTTTGGTTGTTTGGCCTCAATACCTATCTTTTC
 
. : . : . : . : . : . :
JMFN025M20+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFN017J01+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFN042E13+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFN043G24+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMFF006A23- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFF006A23+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMFF025I11- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMFF015F07- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFF015F07+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMSF011P20- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMSF047L08- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFN046L05+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMFF046D11- AAGCACTATGCCTTT
JMFF025I11+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMSF047L08+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMSF011P20+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMSF050I08- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMSF007P08- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMFF046D11+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMSF050I08+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
JMSF007P08+ AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
rJMSF036H08- AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
                      ____________________________________________________________
consensus AAGCACTATGCCTTTAGCATGGGATGAACCAGCAAAAGGTTTCTTCCATTCATTTCCAAG
 
. : . : . : . : . : . :
JMFN025M20+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFN017J01+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFN042E13+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFN043G24+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMFF006A23- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFF006A23+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMFF025I11- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMFF015F07- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFF015F07+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMSF011P20- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMSF047L08- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFN046L05+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFF025I11+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMSF047L08+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMSF011P20+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMSF050I08- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMSF007P08- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMFF046D11+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMSF050I08+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
JMSF007P08+ ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
rJMSF036H08- ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
                      ____________________________________________________________
consensus ATGGGACTTCTTATAAGCCTTGTCAGCCCACCTTTGCCTCCTACGGTGGGACTTCAACTT
 
. : . : . : . : . : . :
JMFN025M20+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFN017J01+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFN042E13+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFN043G24+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMFF006A23- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTAAGTGAAGAAAATTCCGGCT
JMFF006A23+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTAAGTGAAGAAAATTCCGGCT
rJMFF025I11- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMFF015F07- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFF015F07+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMSF011P20- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMSF047L08- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFN046L05+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFF025I11+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMSF047L08+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMSF011P20+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMSF050I08- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMSF007P08- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMFF046D11+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMSF050I08+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
JMSF007P08+ GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
rJMSF036H08- GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
                      ____________________________________________________________
consensus GCGTCCAGCTCCCATACCACGTGTCTTCCCCATGTTTGCTGAGTGAAGAAAATTCCGGCT
 
. : . : . : . : . : . :
JMFN025M20+ TCGGAGAAGGGTCTG
JMFN017J01+ TCGGAGAAGGGTCTGAGGAGGGA
JMFN042E13+ TCGGAGAAGGGTCTGAGGAGGGAGA
JMFN043G24+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCC
rJMFF006A23- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTT
JMFF006A23+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTT
rJMFF025I11- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAA
rJMFF015F07- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAAC
JMFF015F07+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAAC
rJMSF011P20- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAA
rJMSF047L08- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCG
JMFN046L05+ TCGGAGAAGGGTCTGAGGAGGGAGA
JMFF025I11+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAA
JMSF047L08+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCG
JMSF011P20+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAA
rJMSF050I08- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCCTC
rJMSF007P08- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCC
JMFF046D11+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCCTC
JMSF050I08+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCCTC
JMSF007P08+ TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCC
rJMSF036H08- TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCCTCGTGATGG
                      ____________________________________________________________
consensus TCGGAGAAGGGTCTGAGGAGGGAGATGCTATGCAGCCGCTTGATAAAACCCTCGTGATGG