Previous Contig 013033:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF036F13Sequence689007084 (6)gb:AY059775_15646251e-39Arabidopsis thaliana unknown protein (At1g20780) mRNA, complete cds.>gb:AY096753748013033 (2)gb:AE005172_8910344e-44Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC069251_154073
JMSF039O19Sequence687007084 (6)gb:AY059775_15646258e-40Arabidopsis thaliana unknown protein (At1g20780) mRNA, complete cds.>gb:AY096753812013033 (2)pir|E96791|E967911e-47hypothetical protein F15M4.11 [imported] - Arabidopsis thaliana>gb:AE005173_8951

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039O19+ GTGTATCCATCTTCCCCTTGTTTAAGCCAGCCG
                      ____________________________________________________________
consensus GTGTATCCATCTTCCCCTTGTTTAAGCCAGCCG
 
. : . : . : . : . : . :
rJMSF039O19+ CCTTCTATAACTGGATTGTGTAAAGTTCATCGTGGAACATGTTCGCTAAAAGAAACCTTT
rJMSF036F13+ TGGAACATGNTCGCTAAAAGAAACCTTT
                      ____________________________________________________________
consensus CCTTCTATAACTGGATTGTGTAAAGTTCATCGTGGAACATGTTCGCTAAAAGAAACCTTT
 
. : . : . : . : . : . :
rJMSF039O19+ TGTC-TTTGGAAGGACAGGCGGTGGAAGAGTTGGTGGCCCTCCTAGACCATACCAAAGAG
rJMSF036F13+ TGTCTTTTGGAAGGACAGGCGGTGGAAGAGTTGGTGGCCCTCCTAGACCATACCAAAGAG
                      ____________________________________________________________
consensus TGTCTTTTGGAAGGACAGGCGGTGGAAGAGTTGGTGGCCCTCCTAGACCATACCAAAGAG
 
. : . : . : . : . : . :
rJMSF039O19+ AAGGTGGTTGAGGCATCACTCGCGGCTCTGTCATCTTTATTGGACGATGGGGTAGATATT
rJMSF036F13+ AAGGTGGTTGAGGCATCACTCGCGGCTCTGTCATCTTTATTGGACGATGGGGTAGATATT
                      ____________________________________________________________
consensus AAGGTGGTTGAGGCATCACTCGCGGCTCTGTCATCTTTATTGGACGATGGGGTAGATATT
 
. : . : . : . : . : . :
rJMSF039O19+ GAACAAGGAGTGCAGGTATTATGTGAAGCAGAAGGAATCAAGCCCATACTTCAGATATTA
rJMSF036F13+ GAACAAGGAGTGCAGGTATTATGTGAAGCAGAAGGAATCAAGCCCATACTTCAGATATTA
                      ____________________________________________________________
consensus GAACAAGGAGTGCAGGTATTATGTGAAGCAGAAGGAATCAAGCCCATACTTCAGATATTA
 
. : . : . : . : . : . :
rJMSF039O19+ CTTGAGAAACGTACCGAGAATCTGAGGAGAAGGGCAGTTTGGGCAGCCGAGAGGCTTCTA
rJMSF036F13+ CTTGAGAAACGTACCGAGAATCTGAGGAGAAGGGCAGTTTGGGCAGCCGAGAGGCTTCTA
                      ____________________________________________________________
consensus CTTGAGAAACGTACCGAGAATCTGAGGAGAAGGGCAGTTTGGGCAGCCGAGAGGCTTCTA
 
. : . : . : . : . : . :
rJMSF039O19+ CGCACTGATGATATAGCTTATGAGGTTTCGGGTGATCCAAACGTGAGCACAGCACTAGTG
rJMSF036F13+ CGCACTGATGATATAGCTTATGAGGTTTCGGGTGATCCAAACGTGAGCACAGCACTAGTG
                      ____________________________________________________________
consensus CGCACTGATGATATAGCTTATGAGGTTTCGGGTGATCCAAACGTGAGCACAGCACTAGTG
 
. : . : . : . : . : . :
rJMSF039O19+ GATGCTTTCCAGCATGCTGATTATCGTACACGACAGATTGCTGAACGGGCATTGAAGCAT
rJMSF036F13+ GATGCTTTCCAGCATGCTGATTATCGTACACGACAGATTGCTGAACGGGCATTGAAGCAT
                      ____________________________________________________________
consensus GATGCTTTCCAGCATGCTGATTATCGTACACGACAGATTGCTGAACGGGCATTGAAGCAT
 
. : . : . : . : . : . :
rJMSF039O19+ GTTGATAAAATCCCGAATTTCTCTGGTGTCTTCCCGAACATGGGATAGGGATCAGCAAAT
rJMSF036F13+ GTTGATAAAATCCCGAATTTCTCTGGTGTCTTCCCGAACATGGGATAGGGATCAGCAAAT
                      ____________________________________________________________
consensus GTTGATAAAATCCCGAATTTCTCTGGTGTCTTCCCGAACATGGGATAGGGATCAGCAAAT
 
. : . : . : . : . : . :
rJMSF039O19+ GGTTTGAGGTTCTTGTATTTATTTCCACTCTAGAGGTTCTTAAGATAAAATCTAAATCGT
rJMSF036F13+ GGTTTGAGGTTCTTGTATTTATTTCCACTCTAGAGGTTCTTAAGATAAAATCTAAATTGT
                      ____________________________________________________________
consensus GGTTTGAGGTTCTTGTATTTATTTCCACTCTAGAGGTTCTTAAGATAAAATCTAAATTGT
 
. : . : . : . : . : . :
rJMSF039O19+ TTATTGTTCTGTGAAAAGTCAGATGTGCAGGTACATACATTGCTTCCCAATTTTCTTCTT
rJMSF036F13+ TTATTGTTCTGTGAAAAGTCAGATGTGCAGGTACATACATTGCTTCCCAATTTTCTTCTT
                      ____________________________________________________________
consensus TTATTGTTCTGTGAAAAGTCAGATGTGCAGGTACATACATTGCTTCCCAATTTTCTTCTT
 
. : . : . : . : . : . :
rJMSF039O19+ TGTAGATGGTTTTAAATTTTCATTTTTCTTCTCTCCCTTGGTCCATTTTTTCTGGTCATA
rJMSF036F13+ TGTAGATGGTTTTAAATTTTCATTTTTCTTCTCTCCCTTGGTCCATTTTTTCTGGTCATA
                      ____________________________________________________________
consensus TGTAGATGGTTTTAAATTTTCATTTTTCTTCTCTCCCTTGGTCCATTTTTTCTGGTCATA
 
. : . : . : . : . : . :
rJMSF039O19+ ATCTCTCTTTGGTCTTCATTTACTCAGCTATATAGGTTGGAATGTGATATTATTTTTGCT
rJMSF036F13+ ATCTCTCTTTGGTCTTCATTTACTCAGCTATATAGGTTGGAATGTGATATTATTTTTGCT
                      ____________________________________________________________
consensus ATCTCTCTTTGGTCTTCATTTACTCAGCTATATAGGTTGGAATGTGATATTATTTTTGCT
 
. : . : . : . : . : . :
rJMSF039O19+ ATTACTGCAAATTCTGTACTTTTCTTGTGTAGCACACCTCAAACAATCAAAGGTACTTTG
rJMSF036F13+ ATTACTGCAAATTCTGTACTTTTCTTGTGTAGCACACCTCAAACAATCAAAGGTACTTTG
                      ____________________________________________________________
consensus ATTACTGCAAATTCTGTACTTTTCTTGTGTAGCACACCTCAAACAATCAAAGGTACTTTG