Previous Contig 013031:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011C10Sequence605013031 (5)gb:AC007047_15350776e-08Arabidopsis thaliana chromosome 2 clone F16F14 map mi398, complete sequence.>gb:741013031 (5)gb:AP003455_18297289e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMFS087F01Sequence624013031 (5)gb:AC007047_15350773e-09Arabidopsis thaliana chromosome 2 clone F16F14 map mi398, complete sequence.>gb:
JMSF036D07Sequence631003397 (9)704013031 (5)gb:AP003455_18297280.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMSF036E23Sequence636003397 (9)690013031 (5)gb:AP003455_18297280.023Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011C10- AACATTTCCAAACAGA
                      ____________________________________________________________
consensus AACATTTCCAAACAGA
 
. : . : . : . : . : . :
JMFF011C10- ATCAAACTGTTGGTACTTCAAGAACATCTAATGAATTCAATAATTTCAACAACTTGTCTC
                      ____________________________________________________________
consensus ATCAAACTGTTGGTACTTCAAGAACATCTAATGAATTCAATAATTTCAACAACTTGTCTC
 
. : . : . : . : . : . :
JMFF011C10- CTTTTTTGGGTCAGAATCAGCAAGGTGTGAAGCTTCAACTTCTAGATAGCTCCACAGCTA
                      ____________________________________________________________
consensus CTTTTTTGGGTCAGAATCAGCAAGGTGTGAAGCTTCAACTTCTAGATAGCTCCACAGCTA
 
. : . : . : . : . : . :
JMFF011C10- GTGAGCATGAAGAAGATACTGGAAATACTGAGCCTTCTGAAGTTGAAGCAAAGAACGAAT
                      ____________________________________________________________
consensus GTGAGCATGAAGAAGATACTGGAAATACTGAGCCTTCTGAAGTTGAAGCAAAGAACGAAT
 
. : . : . : . : . : . :
JMFF011C10- CATCAGCTGAAACTGATACTATGGATATGGATGTCTTTCCAGGAAAGGCCCATCTTTTAG
                      ____________________________________________________________
consensus CATCAGCTGAAACTGATACTATGGATATGGATGTCTTTCCAGGAAAGGCCCATCTTTTAG
 
. : . : . : . : . : . :
JMFF011C10- ATTCTAATTCTTCCCCATTAAAGAAGGCACCTGAAAGAGACCAATATTTACCCCAACTTA
                      ____________________________________________________________
consensus ATTCTAATTCTTCCCCATTAAAGAAGGCACCTGAAAGAGACCAATATTTACCCCAACTTA
 
. : . : . : . : . : . :
JMFF011C10- CAATTGGTTCCCCCATGGCACTTGTTGAATCTGAAGGCACAAAGAACAGGCTACCTGATA
JMFS087F01- GCACTTGTTGAATCTGAAGGCACAAAGAACAGGCTACCTGATA
                      ____________________________________________________________
consensus CAATTGGTTCCCCCATGGCACTTGTTGAATCTGAAGGCACAAAGAACAGGCTACCTGATA
 
. : . : . : . : . : . :
JMFF011C10- TGAACTTACAGTTTCCTGCTGTACCAGCTGAAGTAACTCCGACAGAACAATTGGAGCAGA
JMFS087F01- TGAACTTACAGTTTCCTGCTGTACCAGCTGAAGTAACTCCGACAGAACAATTGGAGCAGA
                      ____________________________________________________________
consensus TGAACTTACAGTTTCCTGCTGTACCAGCTGAAGTAACTCCGACAGAACAATTGGAGCAGA
 
. : . : . : . : . : . :
JMFF011C10- GTTCAAAAACTCAAAGTTTGGATATGGAATCACTCCTGGCTCAAGCTGATCAGCCAAGTA
JMFS087F01- GTTCAAAAACTCAAAGTTTGGATATGGAATCACTCCTGGCTCAAGCTGATCAGCCAAGTA
                      ____________________________________________________________
consensus GTTCAAAAACTCAAAGTTTGGATATGGAATCACTCCTGGCTCAAGCTGATCAGCCAAGTA
 
. : . : . : . : . : . :
JMFF011C10- CTTCAAAACCTGATCTGTCTCCACTCAATCTTCTTCTAGGACCAGAGCCAAGTAGCAGAT
JMFS087F01- CTTCAAAACCTGATCTGTCTCCACTCAATCTTCTTCTAGGACCAGAGCCAAGTAGCAGAT
rJMFF011C10+ TAGGACCAGAGCCAAGTAGCAGAT
                      ____________________________________________________________
consensus CTTCAAAACCTGATCTGTCTCCACTCAATCTTCTTCTAGGACCAGAGCCAAGTAGCAGAT
 
. : . : . : . : . : . :
JMFF011C10- GGGTGAAGCGTTTGAAACTGAGTAATCATGATGCTGGGCTTGCTCTTGG
JMFS087F01- GGGTGAAGCGTTTGAAACTGAGTAATCATGATGCTGGGCTTGCTCTTGGTACAATGAGTT
rJMFF011C10+ GGGTGAAGCGTTTGAAACTGAGTAATCATGATGCTGGGCTTGCTCTTGGTACAATGAGTT
                      ____________________________________________________________
consensus GGGTGAAGCGTTTGAAACTGAGTAATCATGATGCTGGGCTTGCTCTTGGTACAATGAGTT
 
. : . : . : . : . : . :
JMFS087F01- CAAACTCGAAAGAAGATTCATCTTATGAGAAGTACAGGTTCCGTGGCAAAACTACCCAAG
rJMFF011C10+ CAAACTCGAAAGAAGATTCATCTTATGAGAAGTACAGGTTCCGTGGCAAAACTACCCAAG
                      ____________________________________________________________
consensus CAAACTCGAAAGAAGATTCATCTTATGAGAAGTACAGGTTCCGTGGCAAAACTACCCAAG
 
. : . : . : . : . : . :
JMFS087F01- GTGGCATAACTAGCTCTGGACCAATGACTAGTAAAAATCAAGGTAAGGACTTGATAGCTC
rJMFF011C10+ GTGGCATAACTAGCTCTGGACCAATGACTAGTAAAAATCAAGGTAAGGACTTGATAGCTC
                      ____________________________________________________________
consensus GTGGCATAACTAGCTCTGGACCAATGACTAGTAAAAATCAAGGTAAGGACTTGATAGCTC
 
. : . : . : . : . : . :
JMFS087F01- AGGATAATTGTGCAGGCATAACTGGGAATCCTGAGTCCTATTCTGCAGACAGAGAGCTAT
rJMFF011C10+ AGGATAATTGTGCAGGCATAACTGGGAATCCTGAGTCCTATTCTGCAGACAGAGAGCTAT
                      ____________________________________________________________
consensus AGGATAATTGTGCAGGCATAACTGGGAATCCTGAGTCCTATTCTGCAGACAGAGAGCTAT
 
. : . : . : . : . : . :
JMFS087F01- TAACGTCACACTCCTGGATTCAGAGGTTGCTTCGAAATAGATCTATCACCATGCCGAAGA
rJMFF011C10+ TAACGTCACACTCCTGGATTCAGAGGTTGCTTCGAAATAGAGCTATCACCATGCCGAAGA
                      ____________________________________________________________
consensus TAACGTCACACTCCTGGATTCAGAGGTTGCTTCGAAATAGATCTATCACCATGCCGAAGA
 
. : . : . : . : . : . :
JMFS087F01- AGCCTGAAGTTGTGGTTTGTGAGCCACAGAGCTCAAAATTGGTGGTACCTCCTGAGCAAC
rJMFF011C10+ AGCCTGAAGTTGTGGTTTGTGAGCCACAGAGCTCAAAATTGGTGGTACCTCCTGAGCAAC
rJMSF036D07+ TTGTGAGCCACAGAGCTCAAAATTGGTGGTACCTCCTGAGCAAC
rJMSF036E23+ GCTCAAAATTGGTGGTACCTCCTGAGCAAC
                      ____________________________________________________________
consensus AGCCTGAAGTTGTGGTTTGTGAGCCACAGAGCTCAAAATTGGTGGTACCTCCTGAGCAAC
 
. : . : . : . : . : . :
JMFS087F01- TCGAGAAAAAACAGTTTCCCAGCATAGCTGCCATGGCATTA
rJMFF011C10+ TCGAGAAAAAACAGTTTCCCAGCATAGCTGCCATGGCATTAATGGGAAAGGCCATGAAGG
rJMSF036D07+ TCGAAAAAAAACAGTTTCCCAGCATAGCTGCCATGGCATTAATGGGAAAGGCCATGAAGG
rJMSF036E23+ TCGAGAAAAAACAGTTTCCCAGCATAGCTGCCATGGCATTAATGGGAAAGGCCATGAAGG
                      ____________________________________________________________
consensus TCGAGAAAAAACAGTTTCCCAGCATAGCTGCCATGGCATTAATGGGAAAGGCCATGAAGG
 
. : . : . : . : . : . :
rJMFF011C10+ GCTTCCAGCCATGTGAGTTCCAGAGGAAGGGTCCTTTTGTTGTTTGGAATACTAATGGCT
rJMSF036D07+ GCTTCCAGCCATGTGAGTTCCAGAGGAAGGGTCCTTTTGTTGTTTGGAATACTAATGGCT
rJMSF036E23+ GCTTCCAGCCATGTGAGTTCCAGAGGAAGGGTCCTTTTGTTGTTTGGAATACTAATGGCT
                      ____________________________________________________________
consensus GCTTCCAGCCATGTGAGTTCCAGAGGAAGGGTCCTTTTGTTGTTTGGAATACTAATGGCT
 
. : . : . : . : . : . :
rJMFF011C10+ CCTGAAAACACTTCCTATATGGTAATTCACGCTGGTAGCGTTCTGCCACACGCTGACCAT
rJMSF036D07+ CCTGAAAACACTTCCTATATGGTAATTCACGCTGGTAGCGTTCTGCCACACGCTGACCAT
rJMSF036E23+ CCTGAAAACACTTCCTATATGGTAATTCACGCTGGTAGCGTTCTGCCACACGCTGACCAT
                      ____________________________________________________________
consensus CCTGAAAACACTTCCTATATGGTAATTCACGCTGGTAGCGTTCTGCCACACGCTGACCAT
 
. : . : . : . : . : . :
rJMFF011C10+ GAGCGATGGTCCATAGCTGAATAACGCTGACCTGGGCCCATTTAGCGCTTGTATAATCAA
rJMSF036D07+ GAGCGATGGTCCATAGCTGAATAACGCTGACCTGGGCCCATTTAGCGCTTGTATAATCAA
rJMSF036E23+ GAGCGATGGTCCATAGCTGAATAACGCTGACCTGGGCCCATTTAGCGCTTGTATAATCAA
                      ____________________________________________________________
consensus GAGCGATGGTCCATAGCTGAATAACGCTGACCTGGGCCCATTTAGCGCTTGTATAATCAA
 
. : . : . : . : . : . :
rJMFF011C10+ GCAATCAGG
rJMSF036D07+ GCAATCAGGGGCGCTACTTGTCTGGCTGCTCACTGTACGAGAGCAATCGATTTTTACAGT
rJMSF036E23+ GCAATCAGGGGCGCTACTTGTCTGGCTGCTCACTGTACGAGAGCAATCGATTTTTACAGT
                      ____________________________________________________________
consensus GCAATCAGGGGCGCTACTTGTCTGGCTGCTCACTGTACGAGAGCAATCGATTTTTACAGT
 
. : . : . : . : . : . :
rJMSF036D07+ AATGAGTGAGTTAATGGATGTTATGCATGAGTGAGACGACGATGGATACTAGTGTCTCGA
rJMSF036E23+ AATGAGTGAGTTAATGGATGTTATGCATGAGTGAGACGACGATGGATACTAGTGTCTCGA
                      ____________________________________________________________
consensus AATGAGTGAGTTAATGGATGTTATGCATGAGTGAGACGACGATGGATACTAGTGTCTCGA
 
. : . : . : . : . : . :
rJMSF036D07+ GATCCAAATGAACTCTGCACTTTCAAGTGAACAGCCTCAGTTCTTGCTGGACTTTCATAC
rJMSF036E23+ GATCCAAATGAACTCTGCACTTTCAAGTGAACAGCCTCAGTTCTTGCTGGACTTTCATAC
                      ____________________________________________________________
consensus GATCCAAATGAACTCTGCACTTTCAAGTGAACAGCCTCAGTTCTTGCTGGACTTTCATAC
 
. : . : . : . : . : . :
rJMSF036D07+ ACACATTCTTCTCTCTTCAGCCTTGTTAGGGGGAAGATGGAGTTGCAGAGGCATCCAACC
rJMSF036E23+ ACACATTCTTCTCTCTTCAGCCTTGTTAGGGGGAAGATGGAGTTGCAGAGGCATCCAACC
                      ____________________________________________________________
consensus ACACATTCTTCTCTCTTCAGCCTTGTTAGGGGGAAGATGGAGTTGCAGAGGCATCCAACC
 
. : . : . : . : . : . :
rJMSF036D07+ ATGAAAACACTTATCAATTCAGTGGACTCATATTCTTATTTGCATCACACTCCTTTTTTT
rJMSF036E23+ ATGAAAACACTTATCAATTCAGTGGACTCATATTCTTATTTGCATCACACTCCTTTTTTT
                      ____________________________________________________________
consensus ATGAAAACACTTATCAATTCAGTGGACTCATATTCTTATTTGCATCACACTCCTTTTTTT
 
. : . : . : . : . : . :
rJMSF036D07+ CTTTTTCCTTAATAATGCACTATGGATGTGACTTCAAATAGTAATCTTTCATTATAGGAT
rJMSF036E23+ CTTTTTCCTTAATAATGCACTATGGATGTGACTTCAAATAGTAATCTTTCATTATAGGAT
                      ____________________________________________________________
consensus CTTTTTCCTTAATAATGCACTATGGATGTGACTTCAAATAGTAATCTTTCATTATAGGAT
 
. : . : . : . : . : . :
rJMSF036D07+ TTACGTTAGTTTTCATCACATGTATTTATATGCCACTCTGCTTTTCCT
rJMSF036E23+ TTACGTTAGTTTTCATCACATGTATTTATATGCCACTCTGCTTTTCCTAAAACTGCAAAT
                      ____________________________________________________________
consensus TTACGTTAGTTTTCATCACATGTATTTATATGCCACTCTGCTTTTCCTAAAACTGCAAAT