Previous Contig 013028:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS068C05Sequence638013028 (4)gb:AY047228_15616411e-59Arabidopsis thaliana DNA mismatch repair protein (PMS1) mRNA, complete cds.
JMFS068C07Sequence617013028 (4)gb:AY047228_15616419e-60Arabidopsis thaliana DNA mismatch repair protein (PMS1) mRNA, complete cds.
JMSF036C16Sequence710007077 (3)gb:AK117777_18157933e-81Arabidopsis thaliana At4g02460 mRNA for putative DNA mismatch repair protein (PM766013028 (4)gb:AP005874_18594581e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF036E06Sequence669007077 (3)gb:AK117777_18157934e-82Arabidopsis thaliana At4g02460 mRNA for putative DNA mismatch repair protein (PM734013028 (4)gb:AY047228_15616411e-59Arabidopsis thaliana DNA mismatch repair protein (PMS1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036C16+ CTCAAATGAAGGTCATTGGGCAATT
                      ____________________________________________________________
consensus CTCAAATGAAGGTCATTGGGCAATT
 
. : . : . : . : . : . :
rJMSF036C16+ CCATCTTGGATTTATCATTGGCAAGTTAGATCGAGACCTTTTTATTGTTGATCAGCATGC
                      ____________________________________________________________
consensus CCATCTTGGATTTATCATTGGCAAGTTAGATCGAGACCTTTTTATTGTTGATCAGCATGC
 
. : . : . : . : . : . :
rJMSF036C16+ CGCAGATGAAAAATATAACTATGAACGATTATCAGAGTCAACAATTTTAAACCAGCAACC
JMFS068C07- TTAAACCAGCAACC
JMFS068C05- TTAAACCAGCAACC
rJMSF036E06+ TTAAACCAGCAACC
                      ____________________________________________________________
consensus CGCAGATGAAAAATATAACTATGAACGATTATCAGAGTCAACAATTTTAAACCAGCAACC
 
. : . : . : . : . : . :
rJMSF036C16+ TTTGCTTCGGCCCTTGAAGATGGATTTATCTCCTGAAGAGGAAATAGTTGTTTCCATGAA
JMFS068C07- TTTGCTTCGGCCCTTGAAGATGGATTTATCTCCTGAAGAGGAAATAGTTGTTTCCATGAA
JMFS068C05- TTTGCTTCGGCCCTTGAAGATGGATTTATCTCCTGAAGAGGAAATAGTTGTTTCCATGAA
rJMSF036E06+ TTTGCTTCGGCCCTTGAAGATGGATTTATCTCCTGAAGAGGAAATAGTTGTTTCCATGAA
                      ____________________________________________________________
consensus TTTGCTTCGGCCCTTGAAGATGGATTTATCTCCTGAAGAGGAAATAGTTGTTTCCATGAA
 
. : . : . : . : . : . :
rJMSF036C16+ CATGGACACTATAAGGAAAAATGGGTTTTCCTTGGAAGAAGATTTGCATGCTCCTCCTGG
JMFS068C07- CATGGACACTATAAGGAAAAATGGGTTTTCCTTGGAAGAAGATTTGCATGCTCCTCCTGG
JMFS068C05- CATGGACACTATAAGGAAAAATGGGTTTTCCTTGGAAGAAGATTTGCATGCTCCTCCTGG
rJMSF036E06+ CATGGACACTATAAGGAAAAATGGGTTTTCCTTGGAAGAAGATTTGCATGCTCCTCCTGG
                      ____________________________________________________________
consensus CATGGACACTATAAGGAAAAATGGGTTTTCCTTGGAAGAAGATTTGCATGCTCCTCCTGG
 
. : . : . : . : . : . :
rJMSF036C16+ GCTTCGCTTCAATCTAAAAGCAGTTCCTTTCAGTAAAAACATAACTTTTGGAGTTGCAGA
JMFS068C07- GCTTCGCTTCAATCTAAAAGCAGTTCCTTTCAGTAAAAACATAACTTTTGGAGTTGCAGA
JMFS068C05- GCTTCGCTTCAATCTAAAAGCAGTTCCTTTCAGTAAAAACATAACTTTTGGAGTTGCAGA
rJMSF036E06+ GCTTCGCTTCAATCTAAAAGCAGTTCCTTTCAGTAAAAACATAACTTTTGGAGTTGCAGA
                      ____________________________________________________________
consensus GCTTCGCTTCAATCTAAAAGCAGTTCCTTTCAGTAAAAACATAACTTTTGGAGTTGCAGA
 
. : . : . : . : . : . :
rJMSF036C16+ TGTGAAGGAACTAATTTCTATTCTTGCCAGCAGCCAAGAAGACTGTCATATCACGCTTAG
JMFS068C07- TGTGAAGGAACTAATTTCTATTCTTGCCAGCAGCCAAGAAGACTGTCATATCACGCTTAG
JMFS068C05- TGTGAAGGAACTAATTTCTATTCTTGCCAGCAGCCAAGAAGACTGTCATATCACGCTTAG
rJMSF036E06+ TGTGAAGGAACTAATTTCTATTCTTGCCAGCAGCCAAGAAGACTGTCATATCACGCTTAG
                      ____________________________________________________________
consensus TGTGAAGGAACTAATTTCTATTCTTGCCAGCAGCCAAGAAGACTGTCATATCACGCTTAG
 
. : . : . : . : . : . :
rJMSF036C16+ TTACAGAAAGGATACATCTGATTCAATTTGCCCCCCTAGAGTACGTGCAATGTTAGCATC
JMFS068C07- TTACAGAAAGGATACATCTGATTCAATTTGCCCCCCTAGAGTACGTGCAATGTTAGCATC
JMFS068C05- TTACAGAAAGGATACATCTGATTCAATTTGCCCCCCTAGAGTACGTGCAATGTTAGCATC
rJMSF036E06+ TTACAGAAAGGATACATCTGATTCAATTTGCCCCCCTAGAGTACGTGCAATGTTAGCATC
                      ____________________________________________________________
consensus TTACAGAAAGGATACATCTGATTCAATTTGCCCCCCTAGAGTACGTGCAATGTTAGCATC
 
. : . : . : . : . : . :
rJMSF036C16+ ACGAGCTTGCAGATCATCTGTTATGATTGGAGATCCACTGGGGAGAAATGAGATGCAAAA
JMFS068C07- ACGAGCTTGCAGATCATCTGTTATGATTGGAGATCCACTGGGGAGAAATGAGATGCAAAA
JMFS068C05- ACGAGCTTGCAGATCATCTGTTATGATTGGAGATCCACTGGGGAGAAATGAGATGCAAAA
rJMSF036E06+ ACGAGCTTGCAGATCATCTGTTATGATTGGAGATCCACTGGGGAGAAATGAGATGCAAAA
                      ____________________________________________________________
consensus ACGAGCTTGCAGATCATCTGTTATGATTGGAGATCCACTGGGGAGAAATGAGATGCAAAA
 
. : . : . : . : . : . :
rJMSF036C16+ GATACTTGAACATTTGGCACACTTGAAGTCTCCTTGGAACTGTCCGCATGGGAGACCAAC
JMFS068C07- GATACTTGAACATTTGGCACACTTGAAGTCTCCTTGGAACTGTCCGCATGGGAGACCAAC
JMFS068C05- GATACTTGAACATTTGGCACACTTGAAGTCTCCTTGGAACTGTCCGCATGGGAGACCAAC
rJMSF036E06+ GATACTTGAACATTTGGCACACTTGAAGTCTCCTTGGAACTGTCCGCATGGGAGACCAAC
                      ____________________________________________________________
consensus GATACTTGAACATTTGGCACACTTGAAGTCTCCTTGGAACTGTCCGCATGGGAGACCAAC
 
. : . : . : . : . : . :
rJMSF036C16+ GATGCGTCACTTGATTGACTTGACCACTGTACATAAAAGGTTAGATCCAGATCCAACATT
JMFS068C07- GATGCGTCACTTGATTGACTTGACCACTGTACATAAAAGGTTAGATCCAGATCCAACATT
JMFS068C05- GATGCGTCACTTGATTGACTTGACCACTGTACATAAAAGGTTAGATCCAGATCCAACATT
rJMSF036E06+ GATGCGTCACTTGATTGACTTGACCACTGTACATAAAAGGTTAGATCCAGATCCAACATT
                      ____________________________________________________________
consensus GATGCGTCACTTGATTGACTTGACCACTGTACATAAAAGGTTAGATCCAGATCCAACATT
 
. : . : . : . : . : . :
rJMSF036C16+ GTGAACCCTTTACTTGTGTTGTACTGATCCGACCTAAAATACAAAAGGGGAATCGAATCA
JMFS068C07- GTGAACCCTTTACTTGTGTTGTACTGATCCGACCTAAAATACAAAAGGGGAATCGAATCA
JMFS068C05- GTGAACCCTTTACTTGTGTTGTACTGATCCGACCTAAAATACAAAAGGGGAATCGAATCA
rJMSF036E06+ GTGAACCCTTTACTTGTGTTGTACTGATCCGACCTAAAATACAAAAGGGGAATCGAATCA
                      ____________________________________________________________
consensus GTGAACCCTTTACTTGTGTTGTACTGATCCGACCTAAAATACAAAAGGGGAATCGAATCA
 
. : . : . : . : . : . :
rJMSF036C16+ AGAAGGCTTGCAAAATGTTTTGTCCCGTAAGTTATGCACTGCCACCAACTTATTTTGAAC
JMFS068C07- AGAAGGCTTGCAAAATGTTTTGTCCCGTAAGTTATGCACTGCCACCAACTTATTTTGAAC
JMFS068C05- AGAAGGCTTGCAAAATGTTTTGTCCCGTAAGTTATGCACTGCCACCAACTTATTTTGAAC
rJMSF036E06+ AGAAGGCTTGCAAAATGTTTTGTCCCGTAAGTTATGCACTGCCACCAACTTATTTTGAAC
                      ____________________________________________________________
consensus AGAAGGCTTGCAAAATGTTTTGTCCCGTAAGTTATGCACTGCCACCAACTTATTTTGAAC
 
. : . : . : . : . : . :
rJMSF036C16+ CCTG
JMFS068C07- CCT
JMFS068C05- CCTG
rJMSF036E06+ CCTGTGAAATAGGTGAAAATTTTGTATATACAATCAGTTTTTGAGTTGCATGGATGTTAT
                      ____________________________________________________________
consensus CCTGTGAAATAGGTGAAAATTTTGTATATACAATCAGTTTTTGAGTTGCATGGATGTTAT
 
. : . : . : . : . : . :
rJMSF036E06+ TGTAGTCTTTTTCAATGTAATCAGGTAAGAAAAGAGCCTGCAACCCATTATCCGTTACAT
                      ____________________________________________________________
consensus TGTAGTCTTTTTCAATGTAATCAGGTAAGAAAAGAGCCTGCAACCCATTATCCGTTACAT