Previous Contig 013025:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022C05Sequence606003639 (10)pir|D96563|D965631e-10probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173766013025 (6)gb:AY052306_15626791e-62Arabidopsis thaliana At1g52320/F19K6_7 mRNA, complete cds.>gb:BT000616_1634894 A
JMSF023H22Sequence580003639 (10)pir|D96563|D965631e-10probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173803013025 (6)gb:AY052306_15626792e-66Arabidopsis thaliana At1g52320/F19K6_7 mRNA, complete cds.>gb:BT000616_1634894 A
JMSF036C22Sequence633003639 (10)pir|D96563|D965631e-10probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173682013025 (6)pir|D96563|D965631e-37probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173
JMSF038G05Sequence628003639 (10)pir|D96563|D965631e-10probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173944013025 (6)gb:AY052306_15626794e-81Arabidopsis thaliana At1g52320/F19K6_7 mRNA, complete cds.>gb:BT000616_1634894 A
JMSF043J02Sequence756003639 (10)pir|D96563|D965632e-10probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173810013025 (6)gb:AY052306_15626791e-70Arabidopsis thaliana At1g52320/F19K6_7 mRNA, complete cds.>gb:BT000616_1634894 A
JMSF052I12Sequence612003639 (10)pir|D96563|D965631e-10probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173936013025 (6)gb:AY052306_15626793e-83Arabidopsis thaliana At1g52320/F19K6_7 mRNA, complete cds.>gb:BT000616_1634894 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052I12+ CCAAAATTAAAATCACTTGTTGAGTCGATGGCTAGAATGTGGGAGACCATGAAGGGAC
rJMSF038G05+ GTCGATGGCTAGAATGTGGGAGACCATGAAGGGAC
                      ____________________________________________________________
consensus CCAAAATTAAAATCACTTGTTGAGTCGATGGCTAGAATGTGGGAGACCATGAAGGGAC
 
. : . : . : . : . : . :
rJMSF052I12+ ATCATGAGAATCAATGTCAGATCGTGCTAGCTCTGAGGTCTCTGGATATGTCGCAGTCCC
rJMSF043J02+ C
rJMSF038G05+ ATCATGAGAATCAATGTCAGATCGTGCTAGCTCTGAGGTCTCTGGATATGTCGCAGTCCC
                      ____________________________________________________________
consensus ATCATGAGAATCAATGTCAGATCGTGCTAGCTCTGAGGTCTCTGGATATGTCGCAGTCCC
 
. : . : . : . : . : . :
rJMSF052I12+ CCAAAGAAACAAGTGAGCACCACTATGAACGCACTTACCAGTTAGGTGTTGTTGTACAAG
rJMSF043J02+ CCAAAGAAACAAGTGAGCACCACTATGAACGCACTTACCAGTTAGGTGTTGTTGTACAAG
rJMSF023H22+ TATGAACGCACTTACCAGTTAGGTGTTGTTGTACAAG
rJMSF022C05+ G
rJMSF038G05+ CCAAAGAAACAAGTGAGCACCACTATGAACGCACTTACCAGTTAGGTGTTGTTGTACAAG
                      ____________________________________________________________
consensus CCAAAGAAACAAGTGAGCACCACTATGAACGCACTTACCAGTTAGGTGTTGTTGTACAAG
 
. : . : . : . : . : . :
rJMSF052I12+ AGTGGCATTCACAGTTTGAGAAAATGATAATCCACCAGAAGGAATATATTAGAGGCCTGA
rJMSF043J02+ AGTGGCATTCACAGTTTGAGAAAATGATAATCCACCAGAAGGAATATATTAGAGGCCTGA
rJMSF023H22+ AGTGGCATTCACAGNTTGAGAAAATGATAATCCACCAGAAGGAATATATTAGAGGCCTGA
rJMSF022C05+ AGTGGCATTCACAGTTTGAGAAAATGATAATCCACCAGAAGGAATATATTAGAGGCCTGA
rJMSF038G05+ AGTGGCATTCACAGTTTGAGAAAATGATAATCCACCAGAAGGAATATATTAGAGGCCTGA
                      ____________________________________________________________
consensus AGTGGCATTCACAGTTTGAGAAAATGATAATCCACCAGAAGGAATATATTAGAGGCCTGA
 
. : . : . : . : . : . :
rJMSF052I12+ ACGATTGGTTGAAGCTAAATCTGGTTCCTATTGATACAAATCTGAAGGAAAAGGTTTCAT
rJMSF043J02+ ACGATTGGTTGAAGCTAAATCTGGTTCCTATTGATACAAATCTGAAGGAAAAGGTTTCAT
rJMSF023H22+ ACGATTGGTTGAAGCTAAATCTGGTTCCTATTGATACAAATCTGAAGGAAAAGGTTTCAT
rJMSF022C05+ ACGATTGGTTGAAGCTAAATCTGGTTCCTATTGATACAAATCTGAAGGAAAAGGTTTCAT
rJMSF038G05+ ACGATTGGTTGAAGCTAAATCTGGTTCCTATTGATACAAATCTGAAGGAAAAGGTTTCAT
                      ____________________________________________________________
consensus ACGATTGGTTGAAGCTAAATCTGGTTCCTATTGATACAAATCTGAAGGAAAAGGTTTCAT
 
. : . : . : . : . : . :
rJMSF052I12+ CCCCACAAAGGCCCCAGAACCCTCCAATTCTTGCACTTCTGCATGCCTGGCAAGATCTGA
rJMSF043J02+ CCCCACAAAGGCCCCAGAACCCTCCAATTCTTGCACTTCTGCATGCCTGGCAAGATCTGA
rJMSF023H22+ CCCCACAAAGGCCCCAGAACCCTCCAATTCTTGCACTTCTGCATGCCTGGCAAGATCTGA
rJMSF022C05+ CCCCACAAAGGCCCCAGAACCCTCCAATTCTTGCACTTCTGCATGCCTGGCAAGATCTGA
rJMSF038G05+ CCCCACAAAGGCCCCAGAACCCTCCAATTCTTGCACTTCTGCATGCCTGGCAAGATCTGA
rJMSF036C22+ TGCATGCCTGGCAAGATCTGA
                      ____________________________________________________________
consensus CCCCACAAAGGCCCCAGAACCCTCCAATTCTTGCACTTCTGCATGCCTGGCAAGATCTGA
 
. : . : . : . : . : . :
rJMSF052I12+ TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGC-TTTTCTGCTGTTGTA
rJMSF043J02+ TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGC-TTTTCTGCTGTTGTA
rJMSF023H22+ TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGC-TTTTCTGCTGTTGTA
rJMSF022C05+ TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGC-TTTTCTGCTGTTGTA
rJMSF038G05+ TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGC-TTTTCTGCTGTTGTA
rJMSF036C22+ TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGCTTTTTCTGCTGTTGTA
                      ____________________________________________________________
consensus TTGGGAAGCTTCCTGATGAGCTTGCTAAAACCGCTATTTATAGC-TTTTCTGCTGTTGTA
 
. : . : . : . : . : . :
rJMSF052I12+ AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
rJMSF043J02+ AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
rJMSF023H22+ AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
rJMSF022C05+ AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
rJMSF038G05+ AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
rJMSF036C22+ AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
                      ____________________________________________________________
consensus AATACCATCGTGCAACATCAACTAGATGAGATGAAATTGAAGGACAGGTGTAAGGATACA
 
. : . : . : . : . : . :
rJMSF052I12+ AGAAAGGAGCTTGAAAAGAGGACCAGGCAATTTGAGGACTGGTATCATAAGTATATGCAA
rJMSF043J02+ AGAAAGGAGCTTGAAAAGAGGACCAGGAAATTTGAGGACTGGTATCATAAGTATATGCAA
rJMSF023H22+ AGAAAGGAGCTTGAAAAGAGGACCAGGCAATTTGAGGACTGGTATCATAAGTATATGCAA
rJMSF022C05+ AGAAAGGAGCTTGAAAAGAGGACCAGGCAATTTGAGGACTGGTATCATAAGTATATGCAA
rJMSF038G05+ AGAAAGGAGCTTGAAAAGAGGACCAGGCAATTTGAGGACTGGTATCATAAGTATATGCAA
rJMSF036C22+ AGAAAGGAGCTTGAAAAGAGGACCAGGCAATTTGAGGACTGGTATCATAAGTATATGCAA
                      ____________________________________________________________
consensus AGAAAGGAGCTTGAAAAGAGGACCAGGCAATTTGAGGACTGGTATCATAAGTATATGCAA
 
. : . : . : . : . : . :
rJMSF052I12+ CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
rJMSF043J02+ CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
rJMSF023H22+ CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
rJMSF022C05+ CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
rJMSF038G05+ CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
rJMSF036C22+ CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
                      ____________________________________________________________
consensus CGGAGAACTCCAAACGATGACACAGAACAAGATGGACCTCACGAGGATAACAATGTAATC
 
. : . : . : . : . : . :
rJMSF052I12+ GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
rJMSF043J02+ GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
rJMSF023H22+ GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
rJMSF022C05+ GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
rJMSF038G05+ GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
rJMSF036C22+ GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
                      ____________________________________________________________
consensus GAGCGACAACTACAACTAGAAGCACTGAAGCAGAGGTTGAAAGAGGAGGAGGAGGCCTAC
 
. : . : . : . : . : . :
rJMSF052I12+ ATGAGGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
rJMSF043J02+ ATGAGGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
rJMSF023H22+ ATGAGGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
rJMSF022C05+ ATGATGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
rJMSF038G05+ ATGAGGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
rJMSF036C22+ ATGAGGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
                      ____________________________________________________________
consensus ATGAGGCAGTGTATGCAGGTCAGAGTGAAGTCACTGACTAGTTTAAGAACAGGCCTTCCC
 
. : . : . : . : . : . :
rJMSF052I12+ GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
rJMSF043J02+ GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
rJMSF023H22+ GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
rJMSF022C05+ GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
rJMSF038G05+ GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
rJMSF036C22+ GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
                      ____________________________________________________________
consensus GAACTTTTTCATGCAATGTCAGAATTTTCTCGTGCTTGTTCGATTATGTACCAGACTTTG
 
. : . : . : . : . : . :
rJMSF052I12+ GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
rJMSF043J02+ GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
rJMSF023H22+ GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
rJMSF022C05+ GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
rJMSF038G05+ GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
rJMSF036C22+ GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
                      ____________________________________________________________
consensus GAGTCCATCACACATCCGCTTAACAGAGAGAGCACATAACCGGGTAATGTTTGGCCTCAC
 
. : . : . : . : . : . :
rJMSF052I12+ AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
rJMSF043J02+ AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
rJMSF023H22+ AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
rJMSF022C05+ AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
rJMSF038G05+ AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
rJMSF036C22+ AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
                      ____________________________________________________________
consensus AAGATTTTGCGTTGTTCATAATTTACTCAGAATACATTACATTACATTGTATTGTGTTCT
 
. : . : . : . : . : . :
rJMSF052I12+ GTCATTTTGTGTGCTGAGAAACCCAAAAANCAATGTGAT
rJMSF043J02+ GTCATTTTGTGTGCTGAGAAACCCAAAAAC
rJMSF023H22+ GTCATTTTGTGTGCTGAGAAACCCAAAAACCAATGTGATGTGATATT
rJMSF022C05+ GTCATTTTGTGTGCTGAGAAACCCAAAAA-CAATGTGATGTGATATT
rJMSF038G05+ GTCATTTTGTGTGCTGAGAAACCCAAAAA-CAATGTGATGTGATATTTTACTATGTAATT
rJMSF036C22+ GTCATTTTGTGTGCTGAGAAACCCAAAAA-CAATGTGATGTGATATTTTACTATGTAATT
                      ____________________________________________________________
consensus GTCATTTTGTGTGCTGAGAAACCCAAAAACCAATGTGATGTGATATTTTACTATGTAATT
 
. : . : . : . : . : . :
rJMSF038G05+ TTC
rJMSF036C22+ TTCAATAGTCAACATGGTACTGAGTTCCTTGAATGAACTTTTCATTTCTCAAGTGCTCTG
                      ____________________________________________________________
consensus TTCAATAGTCAACATGGTACTGAGTTCCTTGAATGAACTTTTCATTTCTCAAGTGCTCTG