Previous Contig 013018:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003C19Sequence367004009 (7)gb:BT005726_16386619e-24Arabidopsis thaliana clone RAFL16-03-J03 (R50176) unknown protein (At4g11620) mR780013018 (2)gb:OSJN00092_16947561e-99Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088H09, complete seque
JMSF036A22Sequence670004009 (7)gb:BT005726_16386617e-51Arabidopsis thaliana clone RAFL16-03-J03 (R50176) unknown protein (At4g11620) mR639013018 (2)gb:OSJN00092_16947561e-61Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088H09, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003C19+ TGGAGTATGAGGCGG
                      ____________________________________________________________
consensus TGGAGTATGAGGCGG
 
. : . : . : . : . : . :
rJMSF003C19+ AGCAAGGCGAACTTTTTCAGACTCATGTCGGTCTTCAATGGGTTGTTTTCTGCAGCGAAA
                      ____________________________________________________________
consensus AGCAAGGCGAACTTTTTCAGACTCATGTCGGTCTTCAATGGGTTGTTTTCTGCAGCGAAA
 
. : . : . : . : . : . :
rJMSF003C19+ TGGTTCGGGGATGTGTGCATTTGGAAGAACCCCGTGACAACGGGACTGGTTCACATTCTC
                      ____________________________________________________________
consensus TGGTTCGGGGATGTGTGCATTTGGAAGAACCCCGTGACAACGGGACTGGTTCACATTCTC
 
. : . : . : . : . : . :
rJMSF003C19+ TTCACTTTGCTCGTTTGTTTCCCGGAACTCATTCTCCCAACTGGATTTCTCTACATGTTC
                      ____________________________________________________________
consensus TTCACTTTGCTCGTTTGTTTCCCGGAACTCATTCTCCCAACTGGATTTCTCTACATGTTC
 
. : . : . : . : . : . :
rJMSF003C19+ CTAGTAGGCCTTTGGAATTACCGGTACCGAGCTCAGTACCCTCCTCACATGAACACGAGA
rJMSF036A22+ CGGTACCGAGCTCAGTACCCTCCTCACATGAACACGAGA
                      ____________________________________________________________
consensus CTAGTAGGCCTTTGGAATTACCGGTACCGAGCTCAGTACCCTCCTCACATGAACACGAGA
 
. : . : . : . : . : . :
rJMSF003C19+ ATATCCTTTGCTGATTCAGCACAACCCGACGAGCTCGACGAGGAATTCGACACGTTTCCC
rJMSF036A22+ ATATCCTTTGCTGATTCAGCACAACCCGACGAGCTCGACGAGGAATTCGACACGTTTCCC
                      ____________________________________________________________
consensus ATATCCTTTGCTGATTCAGCACAACCCGACGAGCTCGACGAGGAATTCGACACGTTTCCC
 
. : . : . : . : . : . :
rJMSF003C19+ ACGTCGAGGAGCCCGGACCTGGTAAGAGTGCGGTACGATCGCCTGCGAAGTGTGGCTGGT
rJMSF036A22+ ACGTCGAGGAGCCCGGACCTGGTAAGAGTGCGGTACGATCGCCTGCGAAGTGTGGCTGGT
                      ____________________________________________________________
consensus ACGTCGAGGAGCCCGGACCTGGTAAGAGTGCGGTACGATCGCCTGCGAAGTGTGGCTGGT
 
. : . : . : . : . : . :
rJMSF003C19+ CGGATTCAGACAGCGGTGGGTGATGTAGCGACGCAAGGAGAGCGGGTTCAGGCGCTCCTG
rJMSF036A22+ CGGATTCAGACAGCGGTGGGTGATGTAGCGACGCAAGGAGAGCGGGTTCAGGCGCTCCTG
                      ____________________________________________________________
consensus CGGATTCAGACAGCGGTGGGTGATGTAGCGACGCAAGGAGAGCGGGTTCAGGCGCTCCTG
 
. : . : . : . : . : . :
rJMSF003C19+ AGCTGGCGGGATCCCCGTGCCACAGTCATTTTCATTGTATTCTGCCTTGCTGCTGCCATC
rJMSF036A22+ AGCTGGCGGGATCCCCGTGCCACAGTCATTTTCATTGTATTCTGCCTTGCTGCTGCCATC
                      ____________________________________________________________
consensus AGCTGGCGGGATCCCCGTGCCACAGTCATTTTCATTGTATTCTGCCTTGCTGCTGCCATC
 
. : . : . : . : . : . :
rJMSF003C19+ GTGTTGTACGTGACGCCTTTCCAGTTGTTCGCTATCATGGCGGGGTTTTTCGTGATGCGG
rJMSF036A22+ GTGTTGTACGTGACGCCTTTCCAGTTGTTCGCTATCATGGCGGGGTTTTTCGTGATGCGG
                      ____________________________________________________________
consensus GTGTTGTACGTGACGCCTTTCCAGTTGTTCGCTATCATGGCGGGGTTTTTCGTGATGCGG
 
. : . : . : . : . : . :
rJMSF003C19+ CATCCCATGTTTCGACATAAGTTGCCTCCTGCACCTCTCAACTTCTTCCGCAGATTGCCA
rJMSF036A22+ CATCCCATGTTTCGACATAAGTTGCCTCCTGCACCTCTCAACTTCTTCCGCAGATTGCCA
                      ____________________________________________________________
consensus CATCCCATGTTTCGACATAAGTTGCCTCCTGCACCTCTCAACTTCTTCCGCAGATTGCCA
 
. : . : . : . : . : . :
rJMSF003C19+ GCAAAGACTGATAGTATGTTGTAGGTCATTAAGGTTTGGTCTTCCTGAATCCTGGTACTT
rJMSF036A22+ GCAAAGACTGATAGTATGTTGTAGGTCATTAAGGTTTGGTCTTCCTGAATCCTGGTACTT
                      ____________________________________________________________
consensus GCAAAGACTGATAGTATGTTGTAGGTCATTAAGGTTTGGTCTTCCTGAATCCTGGTACTT
 
. : . : . : . : . : . :
rJMSF003C19+ GAAGGAATCTGGTCTTGCTTTTATCACTTGTGTTTAGATTCTGTTAGATTTTCTGGTGCT
rJMSF036A22+ GAAGGAATCTGGTCTTGCTTTTATCACTTGTGTTTAGATTCTGTTAGATTTTCTGGTGCT
                      ____________________________________________________________
consensus GAAGGAATCTGGTCTTGCTTTTATCACTTGTGTTTAGATTCTGTTAGATTTTCTGGTGCT
 
. : . : . : . : . : . :
rJMSF003C19+ GTCAAGAAGTGTGTAAACAATGTAGTAGAAGGAGAGAGCTAGCT
rJMSF036A22+ GTCAAGAAGTGTGTAAACAATGTAGTAGAAGGAGAGAGCTAGCTTGTAATAAATAGAGAG
                      ____________________________________________________________
consensus GTCAAGAAGTGTGTAAACAATGTAGTAGAAGGAGAGAGCTAGCTTGTAATAAATAGAGAG
 
. : . : . : . : . : . :
rJMSF036A22+ AATGGTTTGTATTATTATGCATGCAATATCCTGCCCAAGAACTCCAACTGTGAGTTGAGT
                      ____________________________________________________________
consensus AATGGTTTGTATTATTATGCATGCAATATCCTGCCCAAGAACTCCAACTGTGAGTTGAGT