Previous Contig 013002:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS033H02Sequence337013002 (2)
JMSF035O07Sequence648019873gb:AC069159_15406962e-36Arabidopsis thaliana chromosome 1 BAC F14G9 genomic sequence, complete sequence.706013002 (2)pir|F96602|F966023e-41hypothetical protein T6H22.8.2 [imported] - Arabidopsis thaliana>gb:AE005173_893

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS033H02+ ACAAAATTTATTCAATATACCATTATCATACTATTTAATAAGGTATTTTGGATTTTTA
rJMSF035O07- TTTTTA
                      ____________________________________________________________
consensus ACAAAATTTATTCAATATACCATTATCATACTATTTAATAAGGTATTTTGGATTTTTA
 
. : . : . : . : . : . :
JMFS033H02+ CATGCGTAACAAAAACTAGCGCATGAGGAAAGTGGAGCCGAAAGCCATGACGGTTTTAGT
rJMSF035O07- CATATGTAACAAAAACTAGCAAATGAGGAAAGTGGAGCCGAAAGCCATGACGATTTTAGT
                      ____________________________________________________________
consensus CATGTGTAACAAAAACTAGCGCATGAGGAAAGTGGAGCCGAAAGCCATGACGGTTTTAGT
 
. : . : . : . : . : . :
JMFS033H02+ AGCTGTGGAAGCACAATAAGTACCATGAGAGCGATAGTCGATAGAGAACCATGAAGCTGA
rJMSF035O07- AGCTGCGGAAGCATAATAAGTACTATGAGAGCGAT-------AGAGA--CGTGAAGCTGA
                      ____________________________________________________________
consensus AGCTGTGGAAGCATAATAAGTACTATGAGAGCGATAGTCGATAGAGAACCGTGAAGCTGA
 
. : . : . : . : . : . :
JMFS033H02+ AAAACAAACTACGTTGCTCNNAATGCGATTGCAGAAACTGTGATCGTGTCACCT-GCTGC
rJMSF035O07- AAAACAAACAACGTTGCTGGTAATGCGATTGCAGAAACTGTGATCATGTCCCCTAGCTGC
                      ____________________________________________________________
consensus AAAACAAACTACGTTGCTGGTAATGCGATTGCAGAAACTGTGATCGTGTCCCCTAGCTGC
 
. : . : . : . : . : . :
JMFS033H02+ CTACCTACCCTCTCCAATGATCTCATGAAGCATAG
rJMSF035O07- CTATCTACCCTCTCTAATGATCTCATGAAGCATAGCCCTGGATGGAGTATCAGTTGTTGA
                      ____________________________________________________________
consensus CTATCTACCCTCTCTAATGATCTCATGAAGCATAGCCCTGGATGGAGTATCAGTTGTTGA
 
. : . : . : . : . : . :
rJMSF035O07- CACACTTGTAGTAGCCACTGATGAATAATCGCCTGTCGTTTGGGAACCATGAATGTCAGT
                      ____________________________________________________________
consensus CACACTTGTAGTAGCCACTGATGAATAATCGCCTGTCGTTTGGGAACCATGAATGTCAGT
 
. : . : . : . : . : . :
rJMSF035O07- CATGAAGCTGCTTCTATCATCAAACTTCCAGTCAGTGAGGTAGCTGGGCCTTGAAGTTAC
                      ____________________________________________________________
consensus CATGAAGCTGCTTCTATCATCAAACTTCCAGTCAGTGAGGTAGCTGGGCCTTGAAGTTAC
 
. : . : . : . : . : . :
rJMSF035O07- GGTTGGTACTTCAGCGTCACCTGAAAGCATTGCCACCACACGGGACATTGATGGCCGCAA
                      ____________________________________________________________
consensus GGTTGGTACTTCAGCGTCACCTGAAAGCATTGCCACCACACGGGACATTGATGGCCGCAA
 
. : . : . : . : . : . :
rJMSF035O07- TGAGGGGGATGCTTGGGTGCACAAAAGCGATACCCCTATCACCCGTTTCACTTCATCCTT
                      ____________________________________________________________
consensus TGAGGGGGATGCTTGGGTGCACAAAAGCGATACCCCTATCACCCGTTTCACTTCATCCTT
 
. : . : . : . : . : . :
rJMSF035O07- ATTGAAACCTGATAGACGTTCATCCATCACATCAACGTCGCGATTATTCTCATGGAGATG
                      ____________________________________________________________
consensus ATTGAAACCTGATAGACGTTCATCCATCACATCAACGTCGCGATTATTCTCATGGAGATG
 
. : . : . : . : . : . :
rJMSF035O07- CCAAGCCCATTCAAGAAGATATATCTTATCTTGTTCCAAGCTCGAGTCAGAGTTTGGCCG
                      ____________________________________________________________
consensus CCAAGCCCATTCAAGAAGATATATCTTATCTTGTTCCAAGCTCGAGTCAGAGTTTGGCCG
 
. : . : . : . : . : . :
rJMSF035O07- ACCACTGACAATCTCCATGGCAACGACTCCNAAGCTAAATACATCAGCCTTCTCAGTAAG
                      ____________________________________________________________
consensus ACCACTGACAATCTCCATGGCAACGACTCCNAAGCTAAATACATCAGCCTTCTCAGTAAG