Previous Contig 013000:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029H12Sequence684019573gb:AB015476_15126024e-39Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.760013000 (2)gb:AY139751_15823721e-96Arabidopsis thaliana AT5g24380/K16H17_9 mRNA, complete cds.>gb:BT005806_1638728
JMSF035N11Sequence631019869699013000 (2)gb:AY139751_15823722e-88Arabidopsis thaliana AT5g24380/K16H17_9 mRNA, complete cds.>gb:BT005806_1638728

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029H12+ GGAGAATGGAGTAGTTGCTGGGCTTATCGGGTGTGGGCTCATAAA
                      ____________________________________________________________
consensus GGAGAATGGAGTAGTTGCTGGGCTTATCGGGTGTGGGCTCATAAA
 
. : . : . : . : . : . :
rJMSF029H12+ ATCCATTGTTTCGACGTCCTCTGATCTGATGCACGATTTCAAGACGGGTCACCTCACGCT
rJMSF035N11+ TGATCTGATGCACGATTTCAAGACGGGTCACCTCACGCT
                      ____________________________________________________________
consensus ATCCATTGTTTCGACGTCCTCTGATCTGATGCACGATTTCAAGACGGGTCACCTCACGCT
 
. : . : . : . : . : . :
rJMSF029H12+ CACTTCCCCTCGATCGATGCTCGTTAGCCAGGGCGTCGGGACTGCAATTGGCTGCGTGGT
rJMSF035N11+ CACTTCCCCTCGATCGATGCTCGTTAGCCAGGGCGTCGGGACTGCAATTGGCTGCGTGGT
                      ____________________________________________________________
consensus CACTTCCCCTCGATCGATGCTCGTTAGCCAGGGCGTCGGGACTGCAATTGGCTGCGTGGT
 
. : . : . : . : . : . :
rJMSF029H12+ GGCTCCTCTCACGTTCTTCCTCTTCTACACCGCCTTTGATGTAGGGGACCAGAACGGGGA
rJMSF035N11+ GGCTCCTCTCACGTTCTTCCTCTTCTACACCGCCTTTGATGTAGGGGACCAGAACGGGGA
                      ____________________________________________________________
consensus GGCTCCTCTCACGTTCTTCCTCTTCTACACCGCCTTTGATGTAGGGGACCAGAACGGGGA
 
. : . : . : . : . : . :
rJMSF029H12+ GTACAAGGCGCCTTATGCTCTCATATACAGAAACATGGCCATCCTAGGCGTCGAAGGCTT
rJMSF035N11+ GTACAAGGCGCCTTATGCTCTCATATACAGAAACATGGCCATCCTAGGCGTCGAAGGCTT
                      ____________________________________________________________
consensus GTACAAGGCGCCTTATGCTCTCATATACAGAAACATGGCCATCCTAGGCGTCGAAGGCTT
 
. : . : . : . : . : . :
rJMSF029H12+ CTCTGCTCTCCCCCGCCATTGCCTGCAGCTTTGTTATGGCTTCTTCGCCTTTGCAGTATC
rJMSF035N11+ CTCTGCTCTCCCCCGCCATTGCCTGCAGCTTTGTTATGGCTTCTTCGCCTTTGCAGTATC
                      ____________________________________________________________
consensus CTCTGCTCTCCCCCGCCATTGCCTGCAGCTTTGTTATGGCTTCTTCGCCTTTGCAGTATC
 
. : . : . : . : . : . :
rJMSF029H12+ TGCCAACCTGACGGGAGACGTAGCCCCAGAGAGCGTCGGGAAATGGGTCCCTCTCCCAAT
rJMSF035N11+ TGCCAACCTGACGAGAGACGTAGCCCCAGAGAGCGTCGGGAAATGGGTCCCTCTCCCAAT
                      ____________________________________________________________
consensus TGCCAACCTGACGGGAGACGTAGCCCCAGAGAGCGTCGGGAAATGGGTCCCTCTCCCAAT
 
. : . : . : . : . : . :
rJMSF029H12+ GGCTATGGCGGTTCCCTTCCTCGTCGGGGCTTCCTTCGCCATTGACATGTGCGTTGGAGC
rJMSF035N11+ GGCTATGGCGGTTCCCTTCCTCGTCGGGGCTTCCTTCGCCATTGACATGTGCGTTGGAGC
                      ____________________________________________________________
consensus GGCTATGGCGGTTCCCTTCCTCGTCGGGGCTTCCTTCGCCATTGACATGTGCGTTGGAGC
 
. : . : . : . : . : . :
rJMSF029H12+ CTTGATCGTGCACGTATGGCATAAGGTTAACGGTAGGAAAGCCGATCTGATGGTCCCTGC
rJMSF035N11+ CTTGATCGTGCACGTATGGCATAAGGTTAACGGTAGGAAAGCCGATCTGATGGTCCCTGC
                      ____________________________________________________________
consensus CTTGATCGTGCACGTATGGCATAAGGTTAACGGTAGGAAAGCCGATCTGATGGTCCCTGC
 
. : . : . : . : . : . :
rJMSF029H12+ AGTGGCATCAGGCCTGATATGTGGTGATGGATTATGGATTCTCCCATCAGCAATTCTTGC
rJMSF035N11+ AGTGGCATCAGGCCTGATATGTGGTGATGGATTATGGATTCTCCCATCAGCAATTCTTGC
                      ____________________________________________________________
consensus AGTGGCATCAGGCCTGATATGTGGTGATGGATTATGGATTCTCCCATCAGCAATTCTTGC
 
. : . : . : . : . : . :
rJMSF029H12+ ATTAGCCAAAATCAAGCCTGGAATCTGCATGAGCTTCTTCCCAACAAAGACCTCTTGAAA
rJMSF035N11+ ATTAGCCAAAATCAAGCCTGGAATCTGCATGAGCTTCTTCCCAACAAAGACCTCTTGAAA
                      ____________________________________________________________
consensus ATTAGCCAAAATCAAGCCTGGAATCTGCATGAGCTTCTTCCCAACAAAGACCTCTTGAAA
 
. : . : . : . : . : . :
rJMSF029H12+ ATCCACCTCAGATTCTGCAATTTCGACAACAATATCACTATTCCAGACTGTCATATACAG
rJMSF035N11+ ATCCACCTCAGATTCTGCAATTTCGACAACAATATCACTATTCCAGACTGTCATATACAG
                      ____________________________________________________________
consensus ATCCACCTCAGATTCTGCAATTTCGACAACAATATCACTATTCCAGACTGTCATATACAG
 
. : . : . : . : . : . :
rJMSF029H12+ ATACCTTCTAGTTTTACAATATGCTTGTAATAGCGTAAATAGGAACAGAAAATCT
rJMSF035N11+ ATACCTTCTAGTTTTACAATATGCTTGTAATAGCGTAAATAGGAACAGAAAATCTGCAAA
                      ____________________________________________________________
consensus ATACCTTCTAGTTTTACAATATGCTTGTAATAGCGTAAATAGGAACAGAAAATCTGCAAA