Previous Contig 012996:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035B16Sequence604006995 (11)gb:LES318955_16845784e-23Lycopersicon esculentum tctr2 gene, exons 1-13.255012996 (3)
JMSF035M11Sequence594006995 (11)gb:LES318955_16845782e-33Lycopersicon esculentum tctr2 gene, exons 1-13.713012996 (3)gb:LES318955_16845785e-64Lycopersicon esculentum tctr2 gene, exons 1-13.
JMSF043P20Sequence741006995 (11)gb:LES318955_16845782e-54Lycopersicon esculentum tctr2 gene, exons 1-13.718012996 (3)gb:LES318955_16845783e-71Lycopersicon esculentum tctr2 gene, exons 1-13.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043P20+ AATGTCAAGGTGTGTGATTTTGGGTTTGTCACGCTTAAAAACACAAACACTTT
                      ____________________________________________________________
consensus AATGTCAAGGTGTGTGATTTTGGGTTTGTCACGCTTAAAAACACAAACACTTT
 
. : . : . : . : . : . :
rJMSF043P20+ CTTGTCATCCAAATCAACAGCTGGAACGCCTGAGTGGATGGCTCCTGAAGTTCTACGTAA
rJMSF035M11+ TCATCCAAATCAACAGCTGGAACGCCTGAGTGGATGGCTCCTGAAGTTCTACGTAA
                      ____________________________________________________________
consensus CTTGTCATCCAAATCAACAGCTGGAACGCCTGAGTGGATGGCTCCTGAAGTTCTACGTAA
 
. : . : . : . : . : . :
rJMSF043P20+ TGAACCTTCAAATGAAAAGTGTGATGTTTATAGCTTTGGTGTTATTCTGTGGGAACTTGC
rJMSF035M11+ TGAACCTTCAAATGAAAAGTGTGATGTTTATAGCTTTGGTGTTATTCTGTGGGAACTTGC
                      ____________________________________________________________
consensus TGAACCTTCAAATGAAAAGTGTGATGTTTATAGCTTTGGTGTTATTCTGTGGGAACTTGC
 
. : . : . : . : . : . :
rJMSF043P20+ AACACTGAGATTACCTTGGAGTGGGATGAACCCTATGCAAGTTGTAGGGGCTGTTGGTTT
rJMSF035M11+ AACACTGAGATTACCTTGGAGTGGGATGAACCCTATGCAAGTTGTAGGGGCTGTTGGTTT
                      ____________________________________________________________
consensus AACACTGAGATTACCTTGGAGTGGGATGAACCCTATGCAAGTTGTAGGGGCTGTTGGTTT
 
. : . : . : . : . : . :
rJMSF043P20+ CCAGAATCGGCGTCTTGAAATCCCAAAAGAAGTCGATCCACTTGTGGCAAGGATAATATG
rJMSF035M11+ CCAGAATCGGCGTCTTGAAATCCCAAAAGAAGTCGATCCACTTGTGGCAAGGATAATATG
                      ____________________________________________________________
consensus CCAGAATCGGCGTCTTGAAATCCCAAAAGAAGTCGATCCACTTGTGGCAAGGATAATATG
 
. : . : . : . : . : . :
rJMSF043P20+ GGAATGTTGGCAGATGGAACCAAATTTGCGGCCATCATTTGCACAGTTAACAGTGGCATT
rJMSF035M11+ GGAATGTTGGCAGATGGAACCAAATTTGCGGCCATCATTTGCACAGTTAACAGTGGCATT
                      ____________________________________________________________
consensus GGAATGTTGGCAGATGGAACCAAATTTGCGGCCATCATTTGCACAGTTAACAGTGGCATT
 
. : . : . : . : . : . :
rJMSF043P20+ AAGGCCATTGCAGCGGCTTGTGATTCCTTCACATGTGGACCAGCCAAGTTCAGCTTTGCC
rJMSF035M11+ AAGGCCATTGCAGCGGCTTGTGATTCCTTCACATGTGGACCAGCCAAGTTCAGCTTTGCC
                      ____________________________________________________________
consensus AAGGCCATTGCAGCGGCTTGTGATTCCTTCACATGTGGACCAGCCAAGTTCAGCTTTGCC
 
. : . : . : . : . : . :
rJMSF043P20+ ACAAGAAATATCTGTAAATTCTACACCCTGATGATTGTCTTCTTATGTCAATAAAAAGGC
rJMSF035B16+ ATGTCAATAAAAAGGC
rJMSF035M11+ ACAAGAAATATCTGTAAATTCTACACCCTGATGATTGTCTTCTTATGTCAATAAAAAGGC
                      ____________________________________________________________
consensus ACAAGAAATATCTGTAAATTCTACACCCTGATGATTGTCTTCTTATGTCAATAAAAAGGC
 
. : . : . : . : . : . :
rJMSF043P20+ GGCCGGCATCATTTGTTCTTTATAGAAAGAGGGATCATTTTCATCTCCCTATGCAAAGCT
rJMSF035B16+ GGCCGGCATCATNTGTTCTNTATAGAAAGAGGGATCATTTTCATCTCCCTANGCAAAGCT
rJMSF035M11+ GGCCGGCATCATTTGTTCTTTATAGAAAGAGGGATCATTTTCATCTCCCTATGCAAAGCT
                      ____________________________________________________________
consensus GGCCGGCATCATTTGTTCTTTATAGAAAGAGGGATCATTTTCATCTCCCTATGCAAAGCT
 
. : . : . : . : . : . :
rJMSF043P20+ GAGAAACGAGAAGTAGGTCATTCGTGGAGGAAGGATGGGAGGGTGTA-GCTCAATCAATC
rJMSF035B16+ GAGAAACGAGAAGTAGNTCATTCGTNGAGGAANGATGGGAGGGTGTATGCTCCATCAATC
rJMSF035M11+ GAGAAACGAGAAGTAGGTCATTCGTGGAGGAAGGATGGGAGGGTGTA-GCTCAATCAATC
                      ____________________________________________________________
consensus GAGAAACGAGAAGTAGGTCATTCGTGGAGGAAGGATGGGAGGGTGTA-GCTCAATCAATC
 
. : . : . : . : . : . :
rJMSF043P20+ AAATATAAGTGTAGAAAGGTGCATATTAGTTGTGTTTCTTGTATAGTGGGATGCTGCTGC
rJMSF035B16+ NAATATAAGTGTAGAAAGGTGCATNTTAGTTGTGTTTCTTGTATAGTGGGATGCTGCTGC
rJMSF035M11+ AAATATAAGTGTAGAAAGGTGCATATTAGTTGTGTTTCTTGTATAGTGGGATGCTGCTGC
                      ____________________________________________________________
consensus AAATATAAGTGTAGAAAGGTGCATATTAGTTGTGTTTCTTGTATAGTGGGATGCTGCTGC
 
. : . : . : . : . : . :
rJMSF043P20+ TGCATATAAGTTTGGGTACGTGTGATTTTTAAA-CCTGTAAAACTTTANCTGTGTTGGCT
rJMSF035B16+ TGCATATAAGTTTGGGTACGTGTGATTTTTAAACCCTGTAAAACTTTA
rJMSF035M11+ TGCATATAAGTTTGGGTACGTGTGATTTTTAAA-CCTGTAAAACTTTA-CTGTGTTGGCT
                      ____________________________________________________________
consensus TGCATATAAGTTTGGGTACGTGTGATTTTTAAA-CCTGTAAAACTTTANCTGTGTTGGCT
 
. : . : . : . : . : . :
rJMSF043P20+ AA
rJMSF035M11+ AAATCTTGCGGCTAAGGAAGTTTTGGTATTCCGCCCAAACCCAGGCAAGGCAGTATGTCT
                      ____________________________________________________________
consensus AAATCTTGCGGCTAAGGAAGTTTTGGTATTCCGCCCAAACCCAGGCAAGGCAGTATGTCT