Previous Contig 012995:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022P17Sequence630006110 (4)gb:AK118963_18169092e-20Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA713012995 (4)gb:AK118963_18169094e-71Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA
JMSF035A22Sequence708006110 (4)gb:AK118963_18169092e-23Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA610012995 (4)gb:AK118963_18169093e-17Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA
JMSF035L21Sequence650006110 (4)gb:AK118963_18169092e-20Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA644012995 (4)gb:AK118963_18169091e-12Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA
JMSF047B19Sequence689006110 (4)gb:AK118963_18169092e-21Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA799012995 (4)gb:AK118963_18169093e-31Arabidopsis thaliana At3g19895 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022P17+ GGATGACCTTTCTGCTGAGGAAGACATCTTTTGTA
                      ____________________________________________________________
consensus GGATGACCTTTCTGCTGAGGAAGACATCTTTTGTA
 
. : . : . : . : . : . :
rJMSF022P17+ ACAGAACCGATACTGCTTATGTAGTTCGAGGCAATCCTAATAAGGAACAATCATTGAGAA
                      ____________________________________________________________
consensus ACAGAACCGATACTGCTTATGTAGTTCGAGGCAATCCTAATAAGGAACAATCATTGAGAA
 
. : . : . : . : . : . :
rJMSF022P17+ GTGTTCTGTCTGATCCCTTATCTGGCGCATTCCTGGAAGATGCTATGTTCGTTTCATGTG
                      ____________________________________________________________
consensus GTGTTCTGTCTGATCCCTTATCTGGCGCATTCCTGGAAGATGCTATGTTCGTTTCATGTG
 
. : . : . : . : . : . :
rJMSF022P17+ GACATTCCTTTGGTGGTTTAATGCTAAGAAGGGTTGTTGAAACGGAAAGATGCACACTCT
                      ____________________________________________________________
consensus GACATTCCTTTGGTGGTTTAATGCTAAGAAGGGTTGTTGAAACGGAAAGATGCACACTCT
 
. : . : . : . : . : . :
rJMSF022P17+ GCAATGCAGAAATTGATCCTGGATCTTTAATCCCTAACCTTGTATTAAGAGCAGCAGCTG
                      ____________________________________________________________
consensus GCAATGCAGAAATTGATCCTGGATCTTTAATCCCTAACCTTGTATTAAGAGCAGCAGCTG
 
. : . : . : . : . : . :
rJMSF022P17+ CTGCAGTGAAGCATGAGGATGACCGGAGATTATTCCATAATGCTGCCCTCAGGAAGCGCA
rJMSF047B19+ TGAGGATGACCGGAGATT-TTCCATAATGCTGCCCTCAGGAAGCGCA
                      ____________________________________________________________
consensus CTGCAGTGAAGCATGAGGATGACCGGAGATTATTCCATAATGCTGCCCTCAGGAAGCGCA
 
. : . : . : . : . : . :
rJMSF022P17+ GGAAAGAAGTGGGTGAATTCAGGGAAAATGGGGAAGTTCCTTCTGAAAATTGTCCATACA
rJMSF047B19+ GGAAAGAAGT-GGTG-ATTCAGGG-AAATGGGGGAGTTCCTTCTGAAAATTGTCCATACA
                      ____________________________________________________________
consensus GGAAAGAAGTGGGTGAATTCAGGGAAAATGGGGGAGTTCCTTCTGAAAATTGTCCATACA
 
. : . : . : . : . : . :
rJMSF022P17+ AAGGTGTTCAGTACCCGTTCTCGGTGAATGAGAAAGTTGTTATTAAGGGAAATAGGAGGA
rJMSF035A22+ ATAGGAGGA
rJMSF047B19+ AAGGTGTTCAGTACCCGTTCTCGGTGAATGAGAAAGTTGTTATTAAGGGAAATAGGAGGA
                      ____________________________________________________________
consensus AAGGTGTTCAGTACCCGTTCTCGGTGAATGAGAAAGTTGTTATTAAGGGAAATAGGAGGA
 
. : . : . : . : . : . :
rJMSF022P17+ CACCAGATAAATTTGTTGGGAAGGAAGCAATAATCACCTCACAATGTCTTAATGGCTGGT
rJMSF035A22+ CACCAGATAAATTTGTTGGGAAGGAAGCAATAATCACCTCACAATGTCTTAATGGCTGGT
rJMSF047B19+ CACCAGATAAATTTGTTGGGAAGGAAGCAATAATCACCTCACAATGTCTTAATGGCTGGT
rJMSF035L21+ TGGGAAGGAAGCAATAATCACCTCACAATGTCTTAATGGCTGGT
                      ____________________________________________________________
consensus CACCAGATAAATTTGTTGGGAAGGAAGCAATAATCACCTCACAATGTCTTAATGGCTGGT
 
. : . : . : . : . : . :
rJMSF022P17+ ACTTGCTTAGGATTCTCGACAGTGGAGAGAATGTTCGCCTTCAATACCGCTCTCTGCAGA
rJMSF035A22+ ACTTGCTTAGGATTCTCGACAGTGGAGAGAATGTTCGCCTTCAATACCGCTCTCTGCAGA
rJMSF047B19+ ACTTGCTTAGGATTCTCGACAGTGGAGAGAATGTTCGCCTTCAATACCGCTCTCTGCAGA
rJMSF035L21+ ACTTGCTTAGGATTCTCGACAGTGGAGAGAATGTTCGCCTTCAATACCGCTCTCTGCAGA
                      ____________________________________________________________
consensus ACTTGCTTAGGATTCTCGACAGTGGAGAGAATGTTCGCCTTCAATACCGCTCTCTGCAGA
 
. : . : . : . : . : . :
rJMSF022P17+ AGTTACTGACTTCCCAGGAAACCGAGGAGAGATGCCATTCACAGCCGGTTCAGAGCAACA
rJMSF035A22+ AGTTACTGACTTCCCAGGAAACCGAGGAGAGATGCCATTCACAGCCGGTTCAGAGCAACA
rJMSF047B19+ AGTTACTGACTTCCCAGGAAACCGAGGAGAGATGCCATTCACAGCCGGTTCAGAGCAACA
rJMSF035L21+ AGTTACTGACTTCCCAGGAAACCGAGGAGAGATGCCATTCACAGCCGGTTCAGAGCAACA
                      ____________________________________________________________
consensus AGTTACTGACTTCCCAGGAAACCGAGGAGAGATGCCATTCACAGCCGGTTCAGAGCAACA
 
. : . : . : . : . : . :
rJMSF022P17+ GCTGATAGTTACCCGTCTCATGTAAATGACCTTTTGGACCCTTGCATTACAATTCCTCCG
rJMSF035A22+ GCTGATAGTTACCCGTCTCATGTAAATGACCTTTTGGACCCTTGCATTACAATTCCTCCG
rJMSF047B19+ GCTGATAGTTACCCGTCTCATGTAAATGACCTTTTGGACCCTTGCATTACAATTCCTCCG
rJMSF035L21+ GCTGATAGTTACCCGTCTCATGTAAATGACCTTTTGGACCCTTGCATTACAATTCCTCCG
                      ____________________________________________________________
consensus GCTGATAGTTACCCGTCTCATGTAAATGACCTTTTGGACCCTTGCATTACAATTCCTCCG
 
. : . : . : . : . : . :
rJMSF022P17+ AATTTGAAATGTATCCTG
rJMSF035A22+ AATTTGAAATGTATCCTGTAAANTGTTAGTTATTGTTTAATTAAATTATCATTGTAGAGA
rJMSF047B19+ AATTTGAAATGTATCCTGTAAATTGTTAGTTATTGTTTAATTAAATTATCATTGTAGAGA
rJMSF035L21+ AATTTGAAATGTATCCTGTAAATTGTTAGTTATTGTTTAATTAAATTATCATTGTAGAGA
                      ____________________________________________________________
consensus AATTTGAAATGTATCCTGTAAATTGTTAGTTATTGTTTAATTAAATTATCATTGTAGAGA
 
. : . : . : . : . : . :
rJMSF035A22+ TAGAGAGAGAGAGAGGAAAAGAAAGAGGATAAATTTCAGAGTCCTCTGAATTGGTAGGCC
rJMSF047B19+ TAGAGAGAGAGAGAGGAAAAGAAAGAGGATAAATTTCAGAGTCCTCTGAATTGGTAGGCC
rJMSF035L21+ TAGAGAGAGAGAGAGGAAAAGAAAGAGGATAAATTTCAGAGTCCTCTGAATTGGTAGGCC
                      ____________________________________________________________
consensus TAGAGAGAGAGAGAGGAAAAGAAAGAGGATAAATTTCAGAGTCCTCTGAATTGGTAGGCC
 
. : . : . : . : . : . :
rJMSF035A22+ GGCTTAAAGAGCATTTTCACTCACAGGAGAGAAAAGGATACGGGGATAACGGACATATGA
rJMSF047B19+ GGCTTAAAGAGCATTTTCACTCACAGGAGAGAAAAGGATACGGGGATAACGGACATATGA
rJMSF035L21+ GGCTTAAAGAGCATTTTCACTCACAGGAGAGAAAAGGATACGGGGATAACGGACATATGA
                      ____________________________________________________________
consensus GGCTTAAAGAGCATTTTCACTCACAGGAGAGAAAAGGATACGGGGATAACGGACATATGA
 
. : . : . : . : . : . :
rJMSF035A22+ ATGTATCTGTAAAATAGTTTTGGCCTAGGATTTATAAGTTTGAGGTAACCCTGATAGATC
rJMSF047B19+ ATGTATCTGTAAAATAGTTTTGGCCTAGGATTTATAAGTTTGAGGTAACCCTGATAGATC
rJMSF035L21+ ATGTATCTGTAAAATAGTTTTGGCCTAGGATTTATAAGTTTGAGGTAACCCTGATAGATC
                      ____________________________________________________________
consensus ATGTATCTGTAAAATAGTTTTGGCCTAGGATTTATAAGTTTGAGGTAACCCTGATAGATC
 
. : . : . : . : . : . :
rJMSF035A22+ ATAGATTTAAGTTAGAATTTTAGTTTACCCTTGTTCTCTCCATCAATTAATCAGTTCATT
rJMSF047B19+ ATAGATTTAAGTTAGAATTTTAGTTTACCCTTGTTCTCTCCATCAATTAATCAGTTCATT
rJMSF035L21+ ATAGATTTAAGTTAGAATTTTAGTTTACCCTTGTTCTCTCCATCAATTAATCAGTTCATT
                      ____________________________________________________________
consensus ATAGATTTAAGTTAGAATTTTAGTTTACCCTTGTTCTCTCCATCAATTAATCAGTTCATT
 
. : . : . : . : . : . :
rJMSF035A22+ CCCATTTTGAAATGGGACAGAAGCTTTGCTTCAAAATTCTATTTTCTGAGAGATAGAAGA
rJMSF047B19+ CCCATTTTGAAATGGGACAGAAGCTTTGCTTCAAAATTCTATTTTCTGAGAGATAGAAGA
rJMSF035L21+ CCCATTTTGAAATGGGACAGAAGCTTTGCTTCAAAATTCTATTTTCTGAGAGATAGAAGA
                      ____________________________________________________________
consensus CCCATTTTGAAATGGGACAGAAGCTTTGCTTCAAAATTCTATTTTCTGAGAGATAGAAGA
 
. : . : . : . : . : . :
rJMSF035A22+ T
rJMSF047B19+ TTCAGCCTTCAGGGTTCTTGAGGAAAT
rJMSF035L21+ TTCAGCCTTCAGGGTTCTTGAGGAAATGTAAAATAATGAACTGAAGCCCAATATAATTGC
                      ____________________________________________________________
consensus TTCAGCCTTCAGGGTTCTTGAGGAAATGTAAAATAATGAACTGAAGCCCAATATAATTGC