Previous Contig 012993:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035L05Sequence655012993 (2)gb:AY086018_15710791e-40Arabidopsis thaliana clone 206791 mRNA, complete sequence.731012993 (2)gb:AY307373_15978202e-29Populus tremula x Populus tremuloides DP1 (DP1) mRNA, complete cds.>gb:AF181998_

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035L05- GATTCAAGAACGCCTTTCCGTCCTG
                      ____________________________________________________________
consensus GATTCAAGAACGCCTTTCCGTCCTG
 
. : . : . : . : . : . :
JMSF035L05- TATAGATCCTGGAAGAATTCTACGTCGCCGATCAGTGAATTCCAGAAAAACTTAGTACGA
                      ____________________________________________________________
consensus TATAGATCCTGGAAGAATTCTACGTCGCCGATCAGTGAATTCCAGAAAAACTTAGTACGA
 
. : . : . : . : . : . :
JMSF035L05- AGTGATGGATCGTAAGTTTCTTATGCAACATTCCAAAGGGCAGTATCCTTTTCTGGATGC
                      ____________________________________________________________
consensus AGTGATGGATCGTAAGTTTCTTATGCAACATTCCAAAGGGCAGTATCCTTTTCTGGATGC
 
. : . : . : . : . : . :
JMSF035L05- AGTATGTTATGTTGATAACAATGAGGATATTGATCCGTCTGGTCCGAACAGTGTCGAAAA
                      ____________________________________________________________
consensus AGTATGTTATGTTGATAACAATGAGGATATTGATCCGTCTGGTCCGAACAGTGTCGAAAA
 
. : . : . : . : . : . :
JMSF035L05- GACGAAGAGGGGATCAAAAGTTGTTGGTGGAGGCCTGCGGCAGTACAGTAACATGGTCTG
                      ____________________________________________________________
consensus GACGAAGAGGGGATCAAAAGTTGTTGGTGGAGGCCTGCGGCAGTACAGTAACATGGTCTG
 
. : . : . : . : . : . :
JMSF035L05- TATGAAGGTCAAAGACAAGGGAAGAACCACTTACAGTGAGGTTGCAGATGAAATTATAGC
                      ____________________________________________________________
consensus TATGAAGGTCAAAGACAAGGGAAGAACCACTTACAGTGAGGTTGCAGATGAAATTATAGC
 
. : . : . : . : . : . :
JMSF035L05- TGATTTTAGAGCAACGGAAGTGAATTCTTCAGTTTCTATGAATGAGTCTGATGAGAAGAA
                      ____________________________________________________________
consensus TGATTTTAGAGCAACGGAAGTGAATTCTTCAGTTTCTATGAATGAGTCTGATGAGAAGAA
 
. : . : . : . : . : . :
JMSF035L05- TATACGTAGACGGGTATATGATGTATTAAATGTCCTTATGGCTCTTGACATTGTTACAAA
                      ____________________________________________________________
consensus TATACGTAGACGGGTATATGATGTATTAAATGTCCTTATGGCTCTTGACATTGTTACAAA
 
. : . : . : . : . : . :
JMSF035L05- GGACAGAAAGGAAATTCAATGGAAGGGACTGCCTACTTCAGCTGGAGTGGATATGGACGA
rJMSF035L05+ GACGA
                      ____________________________________________________________
consensus GGACAGAAAGGAAATTCAATGGAAGGGACTGCCTACTTCAGCTGGAGTGGATATGGACGA
 
. : . : . : . : . : . :
JMSF035L05- AATTAAGGGGATGCGTGCTAAGCTGAAAGATGAGATTAATAAGAAAACTGCATATTTGAA
rJMSF035L05+ AATTAAGGGGATGCGTGCTAAGCTGAAAGATGAGATTAATAAGAAAACTGCATATTTGAA
                      ____________________________________________________________
consensus AATTAAGGGGATGCGTGCTAAGCTGAAAGATGAGATTAATAAGAAAACTGCATATTTGAA
 
. : . : . : . : . : . :
JMSF035L05- AGACCTAGAAGACCAGATTGCAGGTCATCAAGCTCTTATATGGCGGAATCAGCAGTTGTA
rJMSF035L05+ AGACCTAGAAGACCAGATTGCAGGTCATCAAGCTCTTATATGGCGGAATCAGCAGTTGTA
                      ____________________________________________________________
consensus AGACCTAGAAGACCAGATTGCAGGTCATCAAGCTCTTATATGGCGGAATCAGCAGTTGTA
 
. : . : . : . : . : . :
JMSF035L05- CGATTCTAAAAACAGCCCAACCAAGGGATT
rJMSF035L05+ CGATTCTAAAAACAGCCCAACCAAGGGATTCCCTTTGCCTTTTTTAATTGCGAAGACTGC
                      ____________________________________________________________
consensus CGATTCTAAAAACAGCCCAACCAAGGGATTCCCTTTGCCTTTTTTAATTGCGAAGACTGC
 
. : . : . : . : . : . :
rJMSF035L05+ ACCTCATGCTACTGTTGAGATTGAGATTTCTGAGGATATGCAGTTGGTCCACTTCGACTT
                      ____________________________________________________________
consensus ACCTCATGCTACTGTTGAGATTGAGATTTCTGAGGATATGCAGTTGGTCCACTTCGACTT
 
. : . : . : . : . : . :
rJMSF035L05+ CAACAGCACACCTTTCTCTTTGCACGATGATGCTTACGTTCTAAAGTTGATGCGCCACTA
                      ____________________________________________________________
consensus CAACAGCACACCTTTCTCTTTGCACGATGATGCTTACGTTCTAAAGTTGATGCGCCACTA
 
. : . : . : . : . : . :
rJMSF035L05+ CCGGCTCTTAGAGGGTGCACAGGCTTCCCAAACTTCTGCAATCCTCTCTTCATCGCCTTG
                      ____________________________________________________________
consensus CCGGCTCTTAGAGGGTGCACAGGCTTCCCAAACTTCTGCAATCCTCTCTTCATCGCCTTG
 
. : . : . : . : . : . :
rJMSF035L05+ CTCTGATGTGGATTCATCAGTTGGAGGTAGACGGTAGACTTGTTCATTCACTATGAAACT
                      ____________________________________________________________
consensus CTCTGATGTGGATTCATCAGTTGGAGGTAGACGGTAGACTTGTTCATTCACTATGAAACT
 
. : . : . : . : . : . :
rJMSF035L05+ GATACTTTTTGATGAAATGAACATGCACATTTTTCCCCAATATTTCATATCTAGGTGACT
                      ____________________________________________________________
consensus GATACTTTTTGATGAAATGAACATGCACATTTTTCCCCAATATTTCATATCTAGGTGACT
 
. : . : . : . : . : . :
rJMSF035L05+ TGGCTTGGGGGTTAGACGACATACAAGTATTTTATGTATTCCATAGAATAATCGGCGAAA
                      ____________________________________________________________
consensus TGGCTTGGGGGTTAGACGACATACAAGTATTTTATGTATTCCATAGAATAATCGGCGAAA
 
. : . : . : . : . : . :
rJMSF035L05+ AAAAAGAGAGAGATGCTTGTATAGGTTTACAGTTGGATAGTTACAGTTGTGTGGTTTCTT
                      ____________________________________________________________
consensus AAAAAGAGAGAGATGCTTGTATAGGTTTACAGTTGGATAGTTACAGTTGTGTGGTTTCTT
 
. : . : . : . : . : . :
rJMSF035L05+ CTGATATACGACATTGGAATTTCGACAATACAAAGGAGAATTAGATTATTACAAACGACT
                      ____________________________________________________________
consensus CTGATATACGACATTGGAATTTCGACAATACAAAGGAGAATTAGATTATTACAAACGACT
 
. : . : . : . : . : . :
rJMSF035L05+ GAATTTGTAACACAATTTCATGATAGCATTATCTGTTTGAAATTACAATATGATTAAGAT
                      ____________________________________________________________
consensus GAATTTGTAACACAATTTCATGATAGCATTATCTGTTTGAAATTACAATATGATTAAGAT