Previous Contig 012990:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035J22Sequence677012990 (2)gb:AY058859_15643962e-36Arabidopsis thaliana AT5g37360/MNJ8_150 mRNA, complete cds.>gb:AY103300_1578128 663012990 (2)gb:AY058859_15643967e-32Arabidopsis thaliana AT5g37360/MNJ8_150 mRNA, complete cds.>gb:AY103300_1578128

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035J22- GGCTGTCCTTCGTCTTCATCATCGGAATCTTCCCAACTATC
                      ____________________________________________________________
consensus GGCTGTCCTTCGTCTTCATCATCGGAATCTTCCCAACTATC
 
. : . : . : . : . : . :
JMSF035J22- TCTCTCCCCATCTTACCCCTACAATCTCCCACCATGCCCCTTCTCTTCACTGCTCTGCGC
                      ____________________________________________________________
consensus TCTCTCCCCATCTTACCCCTACAATCTCCCACCATGCCCCTTCTCTTCACTGCTCTGCGC
 
. : . : . : . : . : . :
JMSF035J22- CACTTTTCTACATTAATTCTCTCAAATTCTTCAAGTCCTCAAGAACGGTCCCGTTTGCTG
                      ____________________________________________________________
consensus CACTTTTCTACATTAATTCTCTCAAATTCTTCAAGTCCTCAAGAACGGTCCCGTTTGCTG
 
. : . : . : . : . : . :
JMSF035J22- TCACAGAATCCGACTCCCCTAAATCCATCGAACCCGACCCGCAGGCACTTCTTCAAGAAG
                      ____________________________________________________________
consensus TCACAGAATCCGACTCCCCTAAATCCATCGAACCCGACCCGCAGGCACTTCTTCAAGAAG
 
. : . : . : . : . : . :
JMSF035J22- TTGCTGACAGTTTTGTTCTCCCTGCGGATTATTTCTCTCGGCTGCCTCGCGATCTTCGTC
                      ____________________________________________________________
consensus TTGCTGACAGTTTTGTTCTCCCTGCGGATTATTTCTCTCGGCTGCCTCGCGATCTTCGTC
 
. : . : . : . : . : . :
JMSF035J22- TCGATTTGAATGATGCAGCCTTTGATCTTTCAAATGGTCAAGTTAAAACTGAGTGTGGTG
                      ____________________________________________________________
consensus TCGATTTGAATGATGCAGCCTTTGATCTTTCAAATGGTCAAGTTAAAACTGAGTGTGGTG
 
. : . : . : . : . : . :
JMSF035J22- AAGATCTCGGGGAGACATTGCTAAATATAAGTCGAGCATGGGAACAAGCTGACACATCAA
                      ____________________________________________________________
consensus AAGATCTCGGGGAGACATTGCTAAATATAAGTCGAGCATGGGAACAAGCTGACACATCAA
 
. : . : . : . : . : . :
JMSF035J22- CATCCACAGCTTTAATGAAGACGGTTCCTCAGCTGGCAGGCTCTTTGACCGGTTATCAAA
                      ____________________________________________________________
consensus CATCCACAGCTTTAATGAAGACGGTTCCTCAGCTGGCAGGCTCTTTGACCGGTTATCAAA
 
. : . : . : . : . : . :
JMSF035J22- AATCAGTTAGCACTTGGAAAGCGCATATTATCTGCTGGAAGGAGGTTTCAATCCATGGGA
rJMSF035J22+ GGA
                      ____________________________________________________________
consensus AATCAGTTAGCACTTGGAAAGCGCATATTATCTGCTGGAAGGAGGTTTCAATCCATGGGA
 
. : . : . : . : . : . :
JMSF035J22- CAGTATGGTCAGGGTGAAGTGCAGCTGATTGCTAAAGTGATGATGAGGAATGGAAAGCTC
rJMSF035J22+ CAGTATGGTCAGGGTGAAGTGCAGCTGATTGCTAAAGTGATGATGAGGAATGGAAAGCTC
                      ____________________________________________________________
consensus CAGTATGGTCAGGGTGAAGTGCAGCTGATTGCTAAAGTGATGATGAGGAATGGAAAGCTC
 
. : . : . : . : . : . :
JMSF035J22- TTGTCTGCAAGTCCAGTATCTGGAGGCACTGATGAAGAACCAAAGCAACAAATCCGGACC
rJMSF035J22+ TTGTCTGCAAGTCCAGTATCTGGAGGCACTGATGAAGAACCAAAGCAACAAATCCGGACC
                      ____________________________________________________________
consensus TTGTCTGCAAGTCCAGTATCTGGAGGCACTGATGAAGAACCAAAGCAACAAATCCGGACC
 
. : . : . : . : . : . :
JMSF035J22- TTTAAGTTTGGTGAGCTTCAGGTTGCACTGACTTCA
rJMSF035J22+ TTTAAGTTTGGTGAGCTTCAGGTTGCACTGACTTCAGAAAAAGCGTACATTGGAGCTGCT
                      ____________________________________________________________
consensus TTTAAGTTTGGTGAGCTTCAGGTTGCACTGACTTCAGAAAAAGCGTACATTGGAGCTGCT
 
. : . : . : . : . : . :
rJMSF035J22+ ATTGGTGCTGTATTTGGGGTTCTTTCTTGGGGATTAAGCCAAGGTGTTGCAAGTATACCT
                      ____________________________________________________________
consensus ATTGGTGCTGTATTTGGGGTTCTTTCTTGGGGATTAAGCCAAGGTGTTGCAAGTATACCT
 
. : . : . : . : . : . :
rJMSF035J22+ GAAAGCTCATTGCAGTATGCAAATGACAATGCTTTGTTACTTGCTAAGTCACTGCGTGGA
                      ____________________________________________________________
consensus GAAAGCTCATTGCAGTATGCAAATGACAATGCTTTGTTACTTGCTAAGTCACTGCGTGGA
 
. : . : . : . : . : . :
rJMSF035J22+ TCTCTTCTCGTACTTTTCTATTCCTCTACAGCCTTATCCGCTTTTGCTACAGTGGGACTT
                      ____________________________________________________________
consensus TCTCTTCTCGTACTTTTCTATTCCTCTACAGCCTTATCCGCTTTTGCTACAGTGGGACTT
 
. : . : . : . : . : . :
rJMSF035J22+ GTTTTACTTGCCGGACAACTTAAGTCAAGCGATAAGGAATGACCCATTGGCGATGGAAAA
                      ____________________________________________________________
consensus GTTTTACTTGCCGGACAACTTAAGTCAAGCGATAAGGAATGACCCATTGGCGATGGAAAA
 
. : . : . : . : . : . :
rJMSF035J22+ TCTAACATGCTACTTTTATAGAGCGGACTCCTACAAAGACTTGAAAATGTCGAGAGATTT
                      ____________________________________________________________
consensus TCTAACATGCTACTTTTATAGAGCGGACTCCTACAAAGACTTGAAAATGTCGAGAGATTT
 
. : . : . : . : . : . :
rJMSF035J22+ ACAAGTTATTGGTTTGATGGCTGTAACTTGTAAGCTGTCAAGAATTTATGTATATTAAAT
                      ____________________________________________________________
consensus ACAAGTTATTGGTTTGATGGCTGTAACTTGTAAGCTGTCAAGAATTTATGTATATTAAAT
 
. : . : . : . : . : . :
rJMSF035J22+ ATCTCCCAGTTTTTTTCATAATCCTTTTGAACAGATATTACATCTTTTTAGTCGAGTAAA
                      ____________________________________________________________
consensus ATCTCCCAGTTTTTTTCATAATCCTTTTGAACAGATATTACATCTTTTTAGTCGAGTAAA
 
. : . : . : . : . : . :
rJMSF035J22+ TCGTGATAAATATGTAAATGTTTACATCAGAATGCTGATAAGTTATCTAACTCTCCCTAG
                      ____________________________________________________________
consensus TCGTGATAAATATGTAAATGTTTACATCAGAATGCTGATAAGTTATCTAACTCTCCCTAG