Previous Contig 012987:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035J09Sequence592019859pir|G96812|G968122e-22protein F3F9.6 [imported] - Arabidopsis thaliana>gb:AE005173_895362 Arabidopsis 751012987 (2)pir|G96812|G968123e-27protein F3F9.6 [imported] - Arabidopsis thaliana>gb:AE005173_895362 Arabidopsis
JMSF046I22Sequence308020351659012987 (2)pir|G96812|G968123e-19protein F3F9.6 [imported] - Arabidopsis thaliana>gb:AE005173_895362 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046I22+ CCAAGAAAA
rJMSF035J09+ GGAAAAAGAGCTCGTCAACTTTGGCCAAGAAAA
                      ____________________________________________________________
consensus GGAAAAAGAGCTCGTCAACTTTGGCCAAGAAAA
 
. : . : . : . : . : . :
rJMSF046I22+ CGAGAGCCTCAAACAACAACTAAACGAAAAGGCTATCGAGGCATCATCAGCAAAGGCGAA
rJMSF035J09+ CGAGAGCCTCAAACAACAACTAAACGAAAAGGCTATCGAGGCATCATCAGCAAAGGCGAA
                      ____________________________________________________________
consensus CGAGAGCCTCAAACAACAACTAAACGAAAAGGCTATCGAGGCATCATCAGCAAAGGCGAA
 
. : . : . : . : . : . :
rJMSF046I22+ GGGAGAAGAGGCAGCTCTCGAGTTGAACCAGGTTAGAGAAGAGCTGGAANCCACTAGAGA
rJMSF035J09+ GGGAGAAGAGGCAGCTCTCGAGTTGAACCAGGTTAGAGAAGAGCTGGAAACCACTAGAGA
                      ____________________________________________________________
consensus GGGAGAAGAGGCAGCTCTCGAGTTGAACCAGGTTAGAGAAGAGCTGGAAACCACTAGAGA
 
. : . : . : . : . : . :
rJMSF046I22+ CAATTTAACCAGGTTCAATGAACAGCTAGAAGCCAGCGAAAAGGCAAAGGAGGCTTTAGA
rJMSF035J09+ CAATTTAACCAGGTTCAATGAACAGCTAGAAGCCAGCGAAAAGGCAAAGGAGGCTTTAAA
                      ____________________________________________________________
consensus CAATTTAACCAGGTTCAATGAACAGCTAGAAGCCAGCGAAAAGGCAAAGGAGGCTTTAGA
 
. : . : . : . : . : . :
rJMSF046I22+ AACCGAGATGAAAAAACTGCGCATTCAAACCGAGCAATGGAGGAAAGCAGCAGATGCAGC
rJMSF035J09+ AACCGAGATGAAAAAACTGCGCATTCAAACCGAGCAATGGAGGAAAGCAGCAGATGCAGC
                      ____________________________________________________________
consensus AACCGAGATGAAAAAACTGCGCATTCAAACCGAGCAATGGAGGAAAGCAGCAGATGCAGC
 
. : . : . : . : . : . :
rJMSF046I22+ AGCTACAGTTCTTTCCGGGGGCATGGAGATGAACGGCAGAAGGATGTCCGAGAGGTGTGG
rJMSF035J09+ AGCTACAGTTCTTTCCGGGGGCATGGAGATGAACGGCAGAAGGATGTCCGAGAGGTGTGG
                      ____________________________________________________________
consensus AGCTACAGTTCTTTCCGGGGGCATGGAGATGAACGGCAGAAGGATGTCCGAGAGGTGTGG
 
. : . : . : . : . : . :
rJMSF046I22+ ATCAATGGAAAAATACAGCAGCAGTGTATTTGAACCAGGAGTCGGGGGATATGGCAGTTA
rJMSF035J09+ ATCAATGGAAAAATACAGCAGCAGTGTATTTGAACCAGGAGTCGGGGGATATGGCAGTTA
                      ____________________________________________________________
consensus ATCAATGGAAAAATACAGCAGCAGTGTATTTGAACCAGGAGTCGGGGGATATGGCAGTTA
 
. : . : . : . : . : . :
rJMSF046I22+ CATGGGATATCCAGGGTTTCTCGATGACTCTGAGGATGTTTCAGACAGTGGAAAGAAGAA
rJMSF035J09+ CATGGGATATCCAGGGTTTCTCGATGACTCTGAGGATGTTTCAGACAGTGGAAAGAAGAA
                      ____________________________________________________________
consensus CATGGGATATCCAGGGTTTCTCGATGACTCTGAGGATGTTTCAGACAGTGGAAAGAAGAA
 
. : . : . : . : . : . :
rJMSF046I22+ AGGTTCTGGCATAAAAATGTTGGGTGATCTCTGGAAAAAGAAGAACCAGAAATGAACCAT
rJMSF035J09+ AGGTTCTGGCATAAAAATGTTGGGTGATCTCTGGAAAAAGAAGAACCAGAAATGAACCAT
                      ____________________________________________________________
consensus AGGTTCTGGCATAAAAATGTTGGGTGATCTCTGGAAAAAGAAGAACCAGAAATGAACCAT
 
. : . : . : . : . : . :
rJMSF046I22+ TTTTAGCANTAAGGAAGTTGAAGAGAACTAGTTTTTTCTAGTTCTTGTTTTTCTGGCTAC
rJMSF035J09+ TTTTAGCATTAAGGAAGTTGAAGAGAACTAGTTTTTTCTAGTTCTTGTTTTTCTGGCTAC
                      ____________________________________________________________
consensus TTTTAGCATTAAGGAAGTTGAAGAGAACTAGTTTTTTCTAGTTCTTGTTTTTCTGGCTAC
 
. : . : . : . : . : . :
rJMSF046I22+ GAAAATGGTAGTAACATCATGTGTTTCAATCTCTGGCATCTTGGTTATTTATGGATTACT
rJMSF035J09+ GAAAATGGTAGTAACATCATGTGTTTCAATCTCTGGCATCTTGGTTATTTATGGATT-CT
                      ____________________________________________________________
consensus GAAAATGGTAGTAACATCATGTGTTTCAATCTCTGGCATCTTGGTTATTTATGGATTACT
 
. : . : . : . : . : . :
rJMSF046I22+ ATGTTTAGGATTTCGGGTGTTTTTAGTTAGTTAA
rJMSF035J09+ ATGTTTAGGATTT-GGGTGTTTTTAGTTAGTTAAGCACGGCATCAATTCGATGTAGCAAC
                      ____________________________________________________________
consensus ATGTTTAGGATTTCGGGTGTTTTTAGTTAGTTAAGCACGGCATCAATTCGATGTAGCAAC
 
. : . : . : . : . : . :
rJMSF035J09+ AACTTGAACTATGAAATTCTTGCCATTTTCAGAACTTGTTGCAGAAATGAGGCTACCCAA
                      ____________________________________________________________
consensus AACTTGAACTATGAAATTCTTGCCATTTTCAGAACTTGTTGCAGAAATGAGGCTACCCAA