Previous Contig 012984:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012A18Sequence211000818 (4)gb:LES457975_16845972e-12Lycopersicon esculentum mRNA for beta 1,3-glycosyltransferase-like protein I.767012984 (2)gb:LES457975_16845971e-67Lycopersicon esculentum mRNA for beta 1,3-glycosyltransferase-like protein I.
JMSF035I16Sequence628000818 (4)gb:LES457975_16845974e-72Lycopersicon esculentum mRNA for beta 1,3-glycosyltransferase-like protein I.777012984 (2)gb:LES457975_16845971e-62Lycopersicon esculentum mRNA for beta 1,3-glycosyltransferase-like protein I.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012A18+ ATGACTTCATTATTCTTAATGATCATGTGGAGTCCCCCGAAGAGCAAACCAAG
rJMSF035I16+ CNCCAATGACTTCATTATTCTTAATGATCATG-GGAGTCCCCCGAAGAGCAANCCAAG
                      ____________________________________________________________
consensus CNCCAATGACTTCATTATTCTTAATGATCATGTGGAGTCCCCCGAAGAGCAAACCAAG
 
. : . : . : . : . : . :
rJMSF012A18+ AAGACAAAGTTATTCTTCATTCAAGCTGTGGAGAACTGGGAAGCTGAGTTCTATGCTAAG
rJMSF035I16+ AAGACAAAGTTATTCTTCATTCAAGCTGTGGAGAACTGGGAAGCTGAGTTCTATGCTAAG
                      ____________________________________________________________
consensus AAGACAAAGTTATTCTTCATTCAAGCTGTGGAGAACTGGGAAGCTGAGTTCTATGCTAAG
 
. : . : . : . : . : . :
rJMSF012A18+ GTCAATGATGATGTCTTTATTAATCTTGATGCTGTTGGTGCGGTGCTAGCCAGTCATATG
rJMSF035I16+ GTCAATGATGATGTCTTTATTAATCTTGATGCTGTTGGTGCGGTGCTAGCCAGTCATATG
                      ____________________________________________________________
consensus GTCAATGATGATGTCTTTATTAATCTTGATGCTGTTGGTGCGGTGCTAGCCAGTCATATG
 
. : . : . : . : . : . :
rJMSF012A18+ GATAAGCCTCATGCTTACATTGGGTGTATGAAGTCTGGGGAAGTTTTCTCTAAACCAGGG
rJMSF035I16+ GATAAGCCTCATGCTTACATTGGGTGTATGAAGTCTGGGGAAGTTTTCTCTAAACCAGGG
                      ____________________________________________________________
consensus GATAAGCCTCATGCTTACATTGGGTGTATGAAGTCTGGGGAAGTTTTCTCTAAACCAGGG
 
. : . : . : . : . : . :
rJMSF012A18+ CACAAATGGTATGAACCAGATTGGTGGAAATTTGGTGATGGAAAATCGTATATCAGGCAT
rJMSF035I16+ CACAAATGGTATGAACCAGATTGGTGGAAATTTGGTGATGGAAAATCGTATATCAGGCAT
                      ____________________________________________________________
consensus CACAAATGGTATGAACCAGATTGGTGGAAATTTGGTGATGGAAAATCGTATATCAGGCAT
 
. : . : . : . : . : . :
rJMSF012A18+ GCTTCAGGTGAAATATTTGCCATATCAAAGGCTTTAGCTCAGTTTATTTCCATCAACAGA
rJMSF035I16+ GCTTCAGGTGAAATATTTGCCATATCAAAGGCTTTAGCTCAGTTTATTTCCATCAACAGA
                      ____________________________________________________________
consensus GCTTCAGGTGAAATATTTGCCATATCAAAGGCTTTAGCTCAGTTTATTTCCATCAACAGA
 
. : . : . : . : . : . :
rJMSF012A18+ TCAATCCTTCGAATATATGCCCATGATGATGTGAGTGCTGGGTCCTGGTTCATTGGACTT
rJMSF035I16+ TCAATCCTTCGAATATATGCCCATGATGATGTGAGTGCTGGGTCCTGGTTCATTGGACTT
                      ____________________________________________________________
consensus TCAATCCTTCGAATATATGCCCATGATGATGTGAGTGCTGGGTCCTGGTTCATTGGACTT
 
. : . : . : . : . : . :
rJMSF012A18+ AATGTTAAACATGTTGATGAAGGGAAATTTTGCTGTTCATCCTGGTCATCAGGATCTGTA
rJMSF035I16+ AATGTTAAACATGTTGATGAAGGGAAATTTTGCTGTTCATCCTGGTCATCAGGATCTGTA
                      ____________________________________________________________
consensus AATGTTAAACATGTTGATGAAGGGAAATTTTGCTGTTCATCCTGGTCATCAGGATCTGTA
 
. : . : . : . : . : . :
rJMSF012A18+ TGTGGTGCTGTGTGATTTAATGTGCCTACACACTTCAAAGATTCCATATTAAATGTCAAG
rJMSF035I16+ TGTGGTGCTGTGTGATTTAATGTGCCTACACACTTCAAAGATTCCATATTAAATGTCAAG
                      ____________________________________________________________
consensus TGTGGTGCTGTGTGATTTAATGTGCCTACACACTTCAAAGATTCCATATTAAATGTCAAG
 
. : . : . : . : . : . :
rJMSF012A18+ GCAGATATGAATTTACTCCAATTCATTCATTACAATGCAACTTAGAAGGTTACAACAAGC
rJMSF035I16+ GCAGATATGAATTTACTCCAATTCATTCATTACAATGCAACTTAGAAGGTTACAACAAGC
                      ____________________________________________________________
consensus GCAGATATGAATTTACTCCAATTCATTCATTACAATGCAACTTAGAAGGTTACAACAAGC
 
. : . : . : . : . : . :
rJMSF012A18+ TCGTGGTAAGTTTTGATTGTCAAACAAAACCCATAGCGTAAATATTGATAGAGGACAGGC
rJMSF035I16+ TCGTGGTAAGTTTTGATTGTCAAACAAAACCCATAGCGTAAATATTGATAGAGGACAGGC
                      ____________________________________________________________
consensus TCGTGGTAAGTTTTGATTGTCAAACAAAACCCATAGCGTAAATATTGATAGAGGACAGGC
 
. : . : . : . : . : . :
rJMSF012A18+ ATTGGTCTATGACGAGGCACATCGATTTGCAATAACAGCTTGGCCCCAGTTCTTGTGGAA
rJMSF035I16+ ATTGGTCTATGACGAGGCACATCGATTTGCAATAACAGCTTGGCCCCAGTTCTTGTGGAA
                      ____________________________________________________________
consensus ATTGGTCTATGACGAGGCACATCGATTTGCAATAACAGCTTGGCCCCAGTTCTTGTGGAA
 
. : . : . : . : . : . :
rJMSF012A18+ AGACTTGATCTGATCTTGGTTCATTTGTAAATGAATTGTGATACACTGAACTAA
rJMSF035I16+ AGACTTGATCTGATCTTGGTTCATTTGTAAATGAATTGTGATACACTGAACTAACCGAAG
                      ____________________________________________________________
consensus AGACTTGATCTGATCTTGGTTCATTTGTAAATGAATTGTGATACACTGAACTAACCGAAG