Previous Contig 012981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035H19Sequence686012981 (2)gb:AP003684_18319835e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P048682012981 (2)gb:AP003684_18319835e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035H19- GGTTTTTTCTATATGAACGACAGATATAT
rJMSF035H19+ TATATGAACGACAGATATAT
                      ____________________________________________________________
consensus GGTTTTTTCTATATGAACGACAGATATAT
 
. : . : . : . : . : . :
JMSF035H19- ATATTTCCCGGCCTGCACTGCAGTAAGTATATAATACTAGCTAGCCGCCGGCAATAATAA
rJMSF035H19+ ATATTTCCCGGCCTGCANTGCAGTAAGTATATAATACTAGCTAGCCGCCGGCAATAATAA
                      ____________________________________________________________
consensus ATATTTCCCGGCCTGCACTGCAGTAAGTATATAATACTAGCTAGCCGCCGGCAATAATAA
 
. : . : . : . : . : . :
JMSF035H19- TAATTCACGCAAATTAAAGATGCAGAAGATCAGGGACGACGACGGTACCGGTGGAAAAGC
rJMSF035H19+ TAATTCACGCAAATTAAAGATGCAGAAGATCAGGGACGACGACGGTACCGGTGGAAAAGC
                      ____________________________________________________________
consensus TAATTCACGCAAATTAAAGATGCAGAAGATCAGGGACGACGACGGTACCGGTGGAAAAGC
 
. : . : . : . : . : . :
JMSF035H19- TTCATCACGGAAAAGCCTAAAGATCTGTTGTTGTGTTCTTCTGCTTACCATCGTCGTTCT
rJMSF035H19+ TTCATCACGGAAAAGCCTAAAGATCTGTTGTTGTGTTCTTCTGCTTACCATCGTCGTTCT
                      ____________________________________________________________
consensus TTCATCACGGAAAAGCCTAAAGATCTGTTGTTGTGTTCTTCTGCTTACCATCGTCGTTCT
 
. : . : . : . : . : . :
JMSF035H19- TGTCATCGTTTTTGTCTCTCTGTTCTTCACCGTCTTCAAGCCTAAAAACCCCATACTCAC
rJMSF035H19+ TGTCATCGTTTTTGTCTCTCTGTTCTTCACCGTCTTCAAGCCTAAAAACCCCATACTCAC
                      ____________________________________________________________
consensus TGTCATCGTTTTTGTCTCTCTGTTCTTCACCGTCTTCAAGCCTAAAAACCCCATACTCAC
 
. : . : . : . : . : . :
JMSF035H19- TCCCTACCCTACAAAACTCCAAAACGTCCATTTCCGGTTTGACCCAAACCCTTCAATAAG
rJMSF035H19+ TCCCTACCCTACAAAACTCCAAAACGTCCATTTCCGGTTTGACCCAAACCCTTCAATAAG
                      ____________________________________________________________
consensus TCCCTACCCTACAAAACTCCAAAACGTCCATTTCCGGTTTGACCCAAACCCTTCAATAAG
 
. : . : . : . : . : . :
JMSF035H19- CGCCACTCTCAACTTAATCATCAACGTCAAGAATCCAAACCGTGGGGACTTCGAGTACCA
rJMSF035H19+ CGCCACTCTCAACTTAATCATCAACGTCAAGAATCCAAACCGTGGGGACTTCGAGTACCA
                      ____________________________________________________________
consensus CGCCACTCTCAACTTAATCATCAACGTCAAGAATCCAAACCGTGGGGACTTCGAGTACCA
 
. : . : . : . : . : . :
JMSF035H19- GGGTGCCACGGCCAGTCTTGATTACCGAGGCATATCTGTGGCCGGAATCCCCGTCGAACA
rJMSF035H19+ GGGTGCCACGGCCAGTCTTGATTACCGAGGCATATCTGTGGCCGGAATCCCCGTCGAACA
                      ____________________________________________________________
consensus GGGTGCCACGGCCAGTCTTGATTACCGAGGCATATCTGTGGCCGGAATCCCCGTCGAACA
 
. : . : . : . : . : . :
JMSF035H19- CGACACCGTCCCGGGTCGAGGCGAGATTAACGTCACCACTTATGCTAACGTTACCGGCGA
rJMSF035H19+ CGACACCGTCCCGGGTCGAGGCGAGATTAACGTCACCACTTATGCTAACGTTACCGGCGA
                      ____________________________________________________________
consensus CGACACCGTCCCGGGTCGAGGCGAGATTAACGTCACCACTTATGCTAACGTTACCGGCGA
 
. : . : . : . : . : . :
JMSF035H19- CAAGATCGCCGGAAATCCTAGTTTCATGGAGGATATGGCTGCTGGAAGCGTGATGTTCAC
rJMSF035H19+ CAAGATCGCCGGAAATCCTAGTTTCATGGAGGATATGGCTGCTGGAAGCGTGATGTTCAC
                      ____________________________________________________________
consensus CAAGATCGCCGGAAATCCTAGTTTCATGGAGGATATGGCTGCTGGAAGCGTGATGTTCAC
 
. : . : . : . : . : . :
JMSF035H19- GTCGTCTGCGGCCTTGCCTGGAAAGGTAAAAGTGCTTAGGACCCTCAAGATTCATGCCAC
rJMSF035H19+ GTCGTCTGCGGCCTTGCCTGGAAAGGTAAAAGTGCTTAGGACCCTCAAGATTCATGCCAC
                      ____________________________________________________________
consensus GTCGTCTGCGGCCTTGCCTGGAAAGGTAAAAGTGCTTAGGACCCTCAAGATTCATGCCAC
 
. : . : . : . : . : . :
JMSF035H19- GGTTTTTATGACTTGTGATGTTTGTGTTTTCATCAAT-CAGTCGTATTATGTTCAGTC
rJMSF035H19+ GGTTTTTATGACTTGTGATGTTTGTGTTTTCATCAATCCAGTCGTATTATGTTCAGTCCA
                      ____________________________________________________________
consensus GGTTTTTATGACTTGTGATGTTTGTGTTTTCATCAATCCAGTCGTATTATGTTCAGTCCA