Previous Contig 012976:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022L17Sequence616012976 (6)pir|H84857|H848576e-11hypothetical protein At2g42760 [imported] - Arabidopsis thaliana>gb:AC006931_153763012976 (6)pir|H84857|H848573e-14hypothetical protein At2g42760 [imported] - Arabidopsis thaliana>gb:AC006931_153
JMSF023L17Sequence647012976 (6)pir|H84857|H848579e-14hypothetical protein At2g42760 [imported] - Arabidopsis thaliana>gb:AC006931_153762012976 (6)pir|H84857|H848573e-14hypothetical protein At2g42760 [imported] - Arabidopsis thaliana>gb:AC006931_153
JMSF035H06Sequence673012976 (6)pir|H84857|H848572e-14hypothetical protein At2g42760 [imported] - Arabidopsis thaliana>gb:AC006931_153742012976 (6)pir|H84857|H848573e-14hypothetical protein At2g42760 [imported] - Arabidopsis thaliana>gb:AC006931_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022L17- GGTTGTTAGGTGTCATGGACTGTCTCTGGTTTT
JMSF023L17- TGTTAGGTGTCATGGACTGTCTCTGGTTTT
JMSF035H06- TGTTAGGTGTCATGGACTGTCTCTGGTTTT
                      ____________________________________________________________
consensus GGTTGTTAGGTGTCATGGACTGTCTCTGGTTTT
 
. : . : . : . : . : . :
JMSF022L17- ACCAGTCTATATTCTTTACAGAAACCCCTACAGTACTATGTCCAAAACCCCTTGAATCAC
JMSF023L17- ACCAGTCTATATTCTTTACAGAAACCCCTACAGTACTATGTCCAAAACCCCTTGAATCAC
JMSF035H06- ACCAGTCTATATTCTTTACAGAAACCCCTACAGTACTATGTCCAAAACCCCTTGAATCAC
                      ____________________________________________________________
consensus ACCAGTCTATATTCTTTACAGAAACCCCTACAGTACTATGTCCAAAACCCCTTGAATCAC
 
. : . : . : . : . : . :
JMSF022L17- TTCAATATTCTCGAACCTCATCAATGGCAGGAAACGATTCATCTTCAACAGTTGATGAGA
JMSF023L17- TTCAATATTCTCGAACCTCATCAATGGCAGGAAACGATTCATCTTCAACAGTTGATGAGA
JMSF035H06- TTCAATATTCTCGAACCTCATCAATGGCAGGAAACGATTCATCTTCAACAGTTGATGAGA
rJMSF022L17+ ACCTCATCAATGGCAGGAAACGATTCATCTTCAACAGTTGATGAGA
rJMSF023L17+ TCATCAATNGCAGGAAACGATTCATCTTCAACAGNTGATGAGA
                      ____________________________________________________________
consensus TTCAATATTCTCGAACCTCATCAATGGCAGGAAACGATTCATCTTCAACAGTTGATGAGA
 
. : . : . : . : . : . :
JMSF022L17- TAACTTCACAGGATGAAGATGTAGAAGAAGAAGAAGAAGCTAGGCAGAATGAGACCACAG
JMSF023L17- TAACTTCACAGGATGAAGATGTAGAAGAAGAAGAAGAAGCTAGGCAGAATGAGACCACAG
JMSF035H06- TAACTTCACAGGATGAAGATGTAGAAGAAGAAGAAGAAGCTAGGCAGAATGAGACCACAG
rJMSF022L17+ TAACTTCACAGGATGAAGATGTAGAAGAAGAAGANGAAGCTAGGCAGAATGAGACCACAG
rJMSF023L17+ TAACTTCACAGGATGAAGATGTAGAAGAAGAAGAAGAAGCTAGGCAGAATGAGACCACAG
                      ____________________________________________________________
consensus TAACTTCACAGGATGAAGATGTAGAAGAAGAAGAAGAAGCTAGGCAGAATGAGACCACAG
 
. : . : . : . : . : . :
JMSF022L17- CAAAGGAAAGGCTAACAAGATTAGATCTTGCAGCCTGCAAAAGCCAGTCTCATACATCTT
JMSF023L17- CAAAGGAAAGGCTAACAAGATTAGATCTTGCAGCCTGCAAAAGCCAGTCTCATACATCTT
JMSF035H06- CAAAGGAAAGGCTAACAAGATTAGATCTTGCAGCCTGCAAAAGCCAGTCTCATACATCTT
rJMSF022L17+ CAAAGGAAAGGCTAACAAGATTAGATCTTGCAGCCTGCAAAAGCCAGTCTCATACATCTT
rJMSF023L17+ CAAAGGAAAGGCTAACAAGATTAGATCTTGCAGCCTGCAAAAGCCAGTCTCATACATCTT
rJMSF035H06+ AAAAGCCAGTCTCATACATCTT
                      ____________________________________________________________
consensus CAAAGGAAAGGCTAACAAGATTAGATCTTGCAGCCTGCAAAAGCCAGTCTCATACATCTT
 
. : . : . : . : . : . :
JMSF022L17- CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
JMSF023L17- CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
JMSF035H06- CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
rJMSF022L17+ CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
rJMSF023L17+ CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
rJMSF035H06+ CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
                      ____________________________________________________________
consensus CACCCTCTCTTGATAGAAGCTGCAAGAGCTTAGGGGAGCTCGAGCTCGAAGAAGTAAAGG
 
. : . : . : . : . : . :
JMSF022L17- GGTTCATGGATTTAGGTTTCATATTCGACAAAGAACGGACAAGCAAGAAGACGATGAGCG
JMSF023L17- GGTTCATGGATTTAGGTTTCATATTCGACAAAGAACGGACAAGCAAGAAGACGATGAGCG
JMSF035H06- GGTTCATGGATTTAGGTTTCATATTCGGCAAAGAACGGACAAGCAAGAAGACGATGAGCG
rJMSF022L17+ GGTTCATGGATTTAGGTTTCATATTCGACAAAGAACGGACAAGCAAGAAGACGATGAGCG
rJMSF023L17+ GGTTCATGGATTTAGGTTTCATATTCGACAAAGAACGGACAAGCAAGAAGACGATGAGCG
rJMSF035H06+ GGTTCATGGATTTAGGTTTCATATTCGGCAAAGAACGGACAAGCAAGAAGACGATGAGCG
                      ____________________________________________________________
consensus GGTTCATGGATTTAGGTTTCATATTCGACAAAGAACGGACAAGCAAGAAGACGATGAGCG
 
. : . : . : . : . : . :
JMSF022L17- TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
JMSF023L17- TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
JMSF035H06- TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
rJMSF022L17+ TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
rJMSF023L17+ TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
rJMSF035H06+ TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
                      ____________________________________________________________
consensus TCGTTCCTGGCCTGCAAAGACTTCAACTGATCAAAGCTAAACCAGAAAGAGTGTTAAAGA
 
. : . : . : . : . : . :
JMSF022L17- GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
JMSF023L17- GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
JMSF035H06- GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
rJMSF022L17+ GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
rJMSF023L17+ GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
rJMSF035H06+ GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
                      ____________________________________________________________
consensus GTTGGAATTCTCAAAGAGAACACGAAGACGAAGATGACATGGAAAGAGGCAGAGTGAGGC
 
. : . : . : . : . : . :
JMSF022L17- CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
JMSF023L17- CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
JMSF035H06- CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
rJMSF022L17+ CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
rJMSF023L17+ CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
rJMSF035H06+ CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
                      ____________________________________________________________
consensus CTTACCTATCAGAGGCATGGCTCATAAAGAGTCCCAATTCACCATTGCTAAATCTAAGGA
 
. : . : . : . : . : . :
JMSF022L17- TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAG
JMSF023L17- TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAGACATTGGGCCAAAACAG
JMSF035H06- TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAGACATTGGGCCAAAACAG
rJMSF022L17+ TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAGACATTGGGCCAAAACAG
rJMSF023L17+ TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAGACATTGGGCCAAAACAG
rJMSF035H06+ TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAGACATTGGGCCAAAACAG
                      ____________________________________________________________
consensus TGCCAAGGGCCTCTGCAGCTGCTGATGTTAAGAGGCATCTTAGACATTGGGCCAAAACAG
 
. : . : . : . : . : . :
JMSF023L17- TTGCAACTGTGATT
JMSF035H06- TTGCAACTGTGATTCGTCAAGAATCTTGACAGTGCCATGAGAG
rJMSF022L17+ TTGCAACTGTGATTCGTCAAGAATCTTGACAGTGCCATGAGAGATCCTATGGAATTTTCA
rJMSF023L17+ TTGCAACTGTGATTCGTCAAGAATCTTGACAGTGCCATGAGAGATCCTATGGAATTTTCA
rJMSF035H06+ TTGCAACTGTGATTCGTCAAGAATCTTGACAGTGCCATGAGAGATCCTATGGAATTTTCA
                      ____________________________________________________________
consensus TTGCAACTGTGATTCGTCAAGAATCTTGACAGTGCCATGAGAGATCCTATGGAATTTTCA
 
. : . : . : . : . : . :
rJMSF022L17+ TCTGAGAGGCCACAAATAGTAGCCAGCAAAATAATGCACCACGTCACTGCTGACATAGCA
rJMSF023L17+ TCTGAGAGGCCACAAATAGTAGCCAGCAAAATAATGCACCACGTCACTGCTGACATAGCA
rJMSF035H06+ TCTGAGAGGCCACAAATAGTAGCCAGCAAAATAATGCACCACGTCACTGCTGACATAGCA
                      ____________________________________________________________
consensus TCTGAGAGGCCACAAATAGTAGCCAGCAAAATAATGCACCACGTCACTGCTGACATAGCA
 
. : . : . : . : . : . :
rJMSF022L17+ GTGTACCATATACCCTGCCTAGCATACTTTTTGTTCTCCCAGGTTATATATCAACCTCAA
rJMSF023L17+ GTGTACCATATACCCTGCCTAGCATACTTTTTGTTCTCCCAGGTTATATATCAACCTCAA
rJMSF035H06+ GTGTACCATATACCCTGCCTAGCATACTTTTTGTTCTCCCAGGTTATATATCAACCTCAA
                      ____________________________________________________________
consensus GTGTACCATATACCCTGCCTAGCATACTTTTTGTTCTCCCAGGTTATATATCAACCTCAA
 
. : . : . : . : . : . :
rJMSF022L17+ CCTCTCTCAACTAGGTCAACTTCTCCCAGATCTCCACCCACAACTGCAAATACTGAG
rJMSF023L17+ CCTCTCTCAACTAGGTCAACTTCTCCCAGATCTCCACCCACAACTGCAAATACTGAG
rJMSF035H06+ CCTCTCTCAACTAGGTCAACTTCTCCCAGATCTCCACCCACAACTGCAAATACTGAGTTG
                      ____________________________________________________________
consensus CCTCTCTCAACTAGGTCAACTTCTCCCAGATCTCCACCCACAACTGCAAATACTGAGTTG
 
. : . : . : . : . : . :
rJMSF035H06+ TATATAGTTTGGTTTCGTGTAAAATTAAGAAGACTTACCTGGTTCGTTTTGTTATTTAGT
                      ____________________________________________________________
consensus TATATAGTTTGGTTTCGTGTAAAATTAAGAAGACTTACCTGGTTCGTTTTGTTATTTAGT
 
. : . : . : . : . : . :
rJMSF035H06+ TTTACCCGGTTTTGCACTTGTTGCTTCAGATGCCACTTGTACATGTGGGTGTCNAAAAAG
                      ____________________________________________________________
consensus TTTACCCGGTTTTGCACTTGTTGCTTCAGATGCCACTTGTACATGTGGGTGTCNAAAAAG