Previous Contig 012971:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS128B10Sequence566012971 (3)gb:AF094508_18827220.009Homo sapiens dentin phosphoryn mRNA, complete cds.
JMSF022B02Sequence642007013 (5)gb:AB019233_15141901e-14Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB24.>gb:AY128297_1580773012971 (3)gb:AP004708_18437842e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMSF035E10Sequence680007013 (5)gb:AB019233_15141904e-06Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB24.>gb:AY128297_1580716012971 (3)gb:AP004708_18437842e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS128B10- GAAAAG
                      ____________________________________________________________
consensus GAAAAG
 
. : . : . : . : . : . :
JMFS128B10- TACCAAATTTCTTCTAACAGCTGAATTGGGTACTTTTCTTCCACCATTGACCGTAGATGG
                      ____________________________________________________________
consensus TACCAAATTTCTTCTAACAGCTGAATTGGGTACTTTTCTTCCACCATTGACCGTAGATGG
 
. : . : . : . : . : . :
JMFS128B10- AGATGGTGCAGACTCGGTTCTTGACAAGCGCAACTTAGCTGTTAGAAGAAATTTGTTGAA
                      ____________________________________________________________
consensus AGATGGTGCAGACTCGGTTCTTGACAAGCGCAACTTAGCTGTTAGAAGAAATTTGTTGAA
 
. : . : . : . : . : . :
JMFS128B10- AGATCTGGCTCGGCAGCTTGGGTCAGATGAAGAGACAGATGACTTGGTTGATAATGAAAA
                      ____________________________________________________________
consensus AGATCTGGCTCGGCAGCTTGGGTCAGATGAAGAGACAGATGACTTGGTTGATAATGAAAA
 
. : . : . : . : . : . :
JMFS128B10- TGTAGGCCAGAGGGATCTGGTTGATACTGATGGACAAGATGGAGAAAACAAAAATTTTAG
rJMSF022B02+ CCAGAGGGATCTGGTTGATACTGATGGNCAAGATGGAGAAACCAAAAATTTTAG
                      ____________________________________________________________
consensus TGTAGGCCAGAGGGATCTGGTTGATACTGATGGACAAGATGGAGAAACCAAAAATTTTAG
 
. : . : . : . : . : . :
JMFS128B10- TTCCACATCTGAGGAGAGATGTTTCAGCCGAAACACTTGTAGTGAACAGAATTCTTATAT
rJMSF022B02+ TTCCACATCTGAGGAGAGATGTTTCAGCCGAAACACTTGTAGTGAACAGAATTCTTATAT
                      ____________________________________________________________
consensus TTCCACATCTGAGGAGAGATGTTTCAGCCGAAACACTTGTAGTGAACAGAATTCTTATAT
 
. : . : . : . : . : . :
JMFS128B10- TTCTTCTGACCCACCTAGCCCTATTAGTGGTAATAACCATCAGGAAATTGGATCTGACAG
rJMSF022B02+ TTCTTCTGACCCACCTAGCCCTATTAGTGGTAATAACCATCAGGAAATTGGATCTGACAG
rJMSF035E10+ TCTGACCCACCTAGCCCTATTAGTGGTAATAACCATCAGGAAATTGGATCTGACAG
                      ____________________________________________________________
consensus TTCTTCTGACCCACCTAGCCCTATTAGTGGTAATAACCATCAGGAAATTGGATCTGACAG
 
. : . : . : . : . : . :
JMFS128B10- AAGCAGTGTTGCATCAAATTTGTCTGTTGGTGACAATGATGGTGATGCAAGTAACGCTGT
rJMSF022B02+ AAGCAGTGTTGCATCAAATTTGTCTGTTGGTGACAATGATGGTGATGCAAGTAACGCTGT
rJMSF035E10+ AAGCAGTGTTGCATCAAATTTGTCTGTTGGTGACAATGATGGTGATGCAAGTAACGCTGT
                      ____________________________________________________________
consensus AAGCAGTGTTGCATCAAATTTGTCTGTTGGTGACAATGATGGTGATGCAAGTAACGCTGT
 
. : . : . : . : . : . :
JMFS128B10- GGTGTCTGGAACTAACCTAGAAGGATCTCCTCTTCCTCTAGAAGGTGTTTCTGTAAAGTC
rJMSF022B02+ GGTGTCTGGAACTAACCTAGAAGGATCTCCTCTTCCTCTAGAAGGTGTTTCTGTAAAGTC
rJMSF035E10+ GGTGTCTGGAACTAACCTAGAAGGATCTCCTCTTCCTCTAGAAGGTGTTTCTGTAAAGTC
                      ____________________________________________________________
consensus GGTGTCTGGAACTAACCTAGAAGGATCTCCTCTTCCTCTAGAAGGTGTTTCTGTAAAGTC
 
. : . : . : . : . : . :
JMFS128B10- TGAACAAAATGATGATTCTGGAGGGAAATCCACAACTTGCTCAAAGGAGCGGAAGCTTCG
rJMSF022B02+ TGAACAAAATGATGATTCTGGAGGGAAATCCACAACTTGCTCAAAGGAGCGGAAGCTTCG
rJMSF035E10+ TGAACAAAATGATGATTCTGGAGGGAAATCCACAACTTGCTCAAAGGAGCGGAAGCTTCG
                      ____________________________________________________________
consensus TGAACAAAATGATGATTCTGGAGGGAAATCCACAACTTGCTCAAAGGAGCGGAAGCTTCG
 
. : . : . : . : . : . :
JMFS128B10- GTCTGTCAAATTTAACTGGT
rJMSF022B02+ GTCTGTCAAATTTAACTGGTTTTGGAAGTTTGGACGGAATGCTGGTGAAGGGGCATCTGA
rJMSF035E10+ GTCTGTCAAATTTAACTGGTTTTGGAAGTTTGGACGGAATGCTGGTGAAGGGGCATCTGA
                      ____________________________________________________________
consensus GTCTGTCAAATTTAACTGGTTTTGGAAGTTTGGACGGAATGCTGGTGAAGGGGCATCTGA
 
. : . : . : . : . : . :
rJMSF022B02+ AAAAGATAGTGGCCCTGAGGTCACGAAAGTCCCCTGTGGCGGGAACAGTCAGAACAATCA
rJMSF035E10+ AAAAGATAGTGGCCCTGAGGTCACGAAAGTCCCCTGTGGCGGGAACAGTCAGAACAATCA
                      ____________________________________________________________
consensus AAAAGATAGTGGCCCTGAGGTCACGAAAGTCCCCTGTGGCGGGAACAGTCAGAACAATCA
 
. : . : . : . : . : . :
rJMSF022B02+ TATTGGATCTTCTACAATTGAAGGGTTTGATAGTTCTGGCACTAGCAGAGGAGAGAATGT
rJMSF035E10+ TATTGGATCTTCTACAATTGAAGGGTTTGATAGTTCTGGCACTAGCAGAGGAGAGAATGT
                      ____________________________________________________________
consensus TATTGGATCTTCTACAATTGAAGGGTTTGATAGTTCTGGCACTAGCAGAGGAGAGAATGT
 
. : . : . : . : . : . :
rJMSF022B02+ AGACCAGAATTTGTTGGTTTCATTAAGAAATCTTGGGAATTCCATGCTCGAGAATATTCA
rJMSF035E10+ AGACCAGAATTTGTTGGTTTCATTAAGAAATCTTGGGAATTCCATGCTCGAGAATATTCA
                      ____________________________________________________________
consensus AGACCAGAATTTGTTGGTTTCATTAAGAAATCTTGGGAATTCCATGCTCGAGAATATTCA
 
. : . : . : . : . : . :
rJMSF022B02+ GGTGATCGAATCTGTTTTCCAGCAAGATCAGTCTCCAACAGGGCCATTGGAGAACTTGTC
rJMSF035E10+ GGTGATCGAATCTGTTTTCCAGCAAGATCAGTCTCCAACAGGGCCATTGGAGAACTTGTC
                      ____________________________________________________________
consensus GGTGATCGAATCTGTTTTCCAGCAAGATCAGTCTCCAACAGGGCCATTGGAGAACTTGTC
 
. : . : . : . : . : . :
rJMSF022B02+ CAAGAGTGTTCTTGTGGGTAAAGGACAAGCCATGTCAGCTTTAAAGGAGCTTCGAAAAAT
rJMSF035E10+ CAAGAGTGTTCTTGTGGGTAAAGGACAAGCCATGTCAGCTTTAAAGGAGCTTCGAAAAAT
                      ____________________________________________________________
consensus CAAGAGTGTTCTTGTGGGTAAAGGACAAGCCATGTCAGCTTTAAAGGAGCTTCGAAAAAT
 
. : . : . : . : . : . :
rJMSF022B02+ CAGCAACCTTTTATCTGAGATGTGAGGAGCAATAGTAATTTAAACTTGTATATAATTT
rJMSF035E10+ CAGCAACCTTTTATCTGAGATGTGAGGAGCAATAGTAATTTAAACTTGTATATAATTTTG
                      ____________________________________________________________
consensus CAGCAACCTTTTATCTGAGATGTGAGGAGCAATAGTAATTTAAACTTGTATATAATTTTG
 
. : . : . : . : . : . :
rJMSF035E10+ TAATTAATTATTCACGAGTGCTGAAATAATAGGCTTTGTTCTCAAATCTGGATGGGATAT
                      ____________________________________________________________
consensus TAATTAATTATTCACGAGTGCTGAAATAATAGGCTTTGTTCTCAAATCTGGATGGGATAT