Previous Contig 012964:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035C11Sequence647012964 (2)656012964 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035C11- GGGAAAACATTAG
                      ____________________________________________________________
consensus GGGAAAACATTAG
 
. : . : . : . : . : . :
JMSF035C11- GTGCTCTCGCAGTCATGTTCTTCCACCAAGGAAGGGAAGCATGTGCAATGAAAAATGAAC
rJMSF035C11+ TCTCGCAGTCATGTTCTTCCNCCAAGGAAGGGAAGCATGTGCAATGAAAAATGAAC
                      ____________________________________________________________
consensus GTGCTCTCGCAGTCATGTTCTTCCACCAAGGAAGGGAAGCATGTGCAATGAAAAATGAAC
 
. : . : . : . : . : . :
JMSF035C11- CCACTTGTCTTCTCTTTATGATGTATGCCAAATACATATAAGCTTCTTAATTTTTTTTTT
rJMSF035C11+ CCNCTTGTCTTCTCTTTATGATGTATGCCAAATACATATAAGCTTCTTAATTTTTTTTTT
                      ____________________________________________________________
consensus CCACTTGTCTTCTCTTTATGATGTATGCCAAATACATATAAGCTTCTTAATTTTTTTTTT
 
. : . : . : . : . : . :
JMSF035C11- CTTTTTCTGCANGTCNCTTTTCAATCANAAATTCTGATTTATGGCCTTTGTCCTAANAGG
rJMSF035C11+ CTTTTTCTGCATGTCTCTTTTCAATCAGAAATTCTGATTTATGGCCTTTGTCCTAAGAGG
                      ____________________________________________________________
consensus CTTTTTCTGCATGTCTCTTTTCAATCAGAAATTCTGATTTATGGCCTTTGTCCTAAGAGG
 
. : . : . : . : . : . :
JMSF035C11- AAATTTTGGGGTCTTCAATGATCTGGAGGAAGTTCACAGTAAATTTTTTATGGATTANAG
rJMSF035C11+ AAATTTTGGGGTCTTCAATGATCTGGAGGAAGTTCACAGTAAATTTTTTATGGATTAGAG
                      ____________________________________________________________
consensus AAATTTTGGGGTCTTCAATGATCTGGAGGAAGTTCACAGTAAATTTTTTATGGATTAGAG
 
. : . : . : . : . : . :
JMSF035C11- CCACTTTAAAATGATATAAAAGAGAATAANGATAATTACTTCTNGGTTCTTTTCTTTGNG
rJMSF035C11+ CCACTTTAAAATGATATAAAAGAGAATAATGATAATTACTTCTTGGTTCTTTTCTTTGTG
                      ____________________________________________________________
consensus CCACTTTAAAATGATATAAAAGAGAATAATGATAATTACTTCTTGGTTCTTTTCTTTGTG
 
. : . : . : . : . : . :
JMSF035C11- CTTCAATGTANATGTGTGGGTCTCACCATGGAACATGTATTTATAGGCACAACTTCTCAC
rJMSF035C11+ CTTCAATGTAGATGTGTGGGTCTCACCATGGAACATGTATTTATAGGCACAACTTCTCAC
                      ____________________________________________________________
consensus CTTCAATGTAGATGTGTGGGTCTCACCATGGAACATGTATTTATAGGCACAACTTCTCAC
 
. : . : . : . : . : . :
JMSF035C11- AAAAATTCAGTTTCAAAAATGAATCATTATTTTTAGATGCCNGTTTTCGAAAACTAAATA
rJMSF035C11+ AAAAATTCAGTTTCAAAAATGAATCATTATTTTTAGATGCCTGTTTTCGAAAACTAAATA
                      ____________________________________________________________
consensus AAAAATTCAGTTTCAAAAATGAATCATTATTTTTAGATGCCTGTTTTCGAAAACTAAATA
 
. : . : . : . : . : . :
JMSF035C11- TTACATTGGCAAATTAAATAAACCATTTTGCTATAGNGATCTCCATTTTTATACATTTTT
rJMSF035C11+ TTACATTGGCAAATTAAATAAACCATTTTGCTATAGTGATCTCCATTTTTATACATTTTT
                      ____________________________________________________________
consensus TTACATTGGCAAATTAAATAAACCATTTTGCTATAGTGATCTCCATTTTTATACATTTTT
 
. : . : . : . : . : . :
JMSF035C11- CCAGATTCATAAATCAATTTTTTATTTCATATACAAAATTACATTTTTAAAAAAAATTAA
rJMSF035C11+ CCAGATTCATAAATCAATTTTTTATTTCATATACAAAATTACATTTTTAAAAAAAATTAA
                      ____________________________________________________________
consensus CCAGATTCATAAATCAATTTTTTATTTCATATACAAAATTACATTTTTAAAAAAAATTAA
 
. : . : . : . : . : . :
JMSF035C11- TTCAAACATATGTTAAGGAGAAATATAGGACTTTTTGGATTAATCTAAAGACATACTTAA
rJMSF035C11+ TTCAAACATATGTTAAGGAGAAATATAGGACTTTTTGGATTAATCTAAAGACATACTTAA
                      ____________________________________________________________
consensus TTCAAACATATGTTAAGGAGAAATATAGGACTTTTTGGATTAATCTAAAGACATACTTAA
 
. : . : . : . : . : . :
JMSF035C11- TTCTGTTTTTTTTTCCCAAAAAATAAATCTTTAA
rJMSF035C11+ TTCTGTTTTTTTTTCCCAAAAAATAAATCTTTAAGTTTTCTTGTTTATTTACATAATCCT
                      ____________________________________________________________
consensus TTCTGTTTTTTTTTCCCAAAAAATAAATCTTTAAGTTTTCTTGTTTATTTACATAATCCT