Previous Contig 012960:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005B20Sequence309004676 (2)gb:AY065250_15664012e-29Arabidopsis thaliana putative alcohol dehydrogenase (At1g64710) mRNA, complete c298012960 (2)gb:AY640383_16189802e-16Helianthus annuus NIM1-like protein 1 (NML1) mRNA, complete cds.
JMSF035A14Sequence703003177 (4)gb:AY640382_16189796e-17Nicotiana tabacum NIM1-like protein 1 (NML1) mRNA, complete cds.764012960 (2)gb:AY640382_16189794e-89Nicotiana tabacum NIM1-like protein 1 (NML1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035A14+ GGATGGACCAAGTGCAGTGAGAATCTGCAGGCGGTTAACTAGGC
                      ____________________________________________________________
consensus GGATGGACCAAGTGCAGTGAGAATCTGCAGGCGGTTAACTAGGC
 
. : . : . : . : . : . :
rJMSF035A14+ CGAAAGATTATCATGCAAAANCAGAACAAGGCCAGGAAGCGAACAAAGACAGGATATGTA
                      ____________________________________________________________
consensus CGAAAGATTATCATGCAAAANCAGAACAAGGCCAGGAAGCGAACAAAGACAGGATATGTA
 
. : . : . : . : . : . :
rJMSF035A14+ TTGATGTCTTAGAGAGGGAGATGCTCAGGAAACCAATGGCTGCTGATGGGTTATCCTCTT
                      ____________________________________________________________
consensus TTGATGTCTTAGAGAGGGAGATGCTCAGGAAACCAATGGCTGCTGATGGGTTATCCTCTT
 
. : . : . : . : . : . :
rJMSF035A14+ CGCCGATGATGGCTGATGATCTGCACATGAAACTCCTTTACCTGGAAAATAGAGTGGCAT
                      ____________________________________________________________
consensus CGCCGATGATGGCTGATGATCTGCACATGAAACTCCTTTACCTGGAAAATAGAGTGGCAT
 
. : . : . : . : . : . :
rJMSF005B20+ TAAACTAGCCATGGAAATTGCAAATGCTGAGA
rJMSF035A14+ TTGCACGACTACTATTCCCCCTTGAAGCTAAACTAGCCATGGAAATTGCAAATGCTGAGA
                      ____________________________________________________________
consensus TTGCACGACTACTATTCCCCCTTGAAGCTAAACTAGCCATGGAAATTGCAAATGCTGAGA
 
. : . : . : . : . : . :
rJMSF005B20+ TGACAGCTGAGTTTGCTGGTTTCTTGGCATCTAAAGGTTCAAATGGGAATTTGAGGGAGG
rJMSF035A14+ TGACAGCTGAGTTTGCTGGTTTCTTGGCATCTAAAGGTTCAAATGGGAATTTGAGGGAGG
                      ____________________________________________________________
consensus TGACAGCTGAGTTTGCTGGTTTCTTGGCATCTAAAGGTTCAAATGGGAATTTGAGGGAGG
 
. : . : . : . : . : . :
rJMSF005B20+ TGGATTTGAACGAGACACCAATAATGCAGAATAATAGACTTCTGTCAAGGTTAGAAGCCC
rJMSF035A14+ TGGATTTGAACGAGACACCAATAATGCAGAATAATAGACTTCTGTCAAGGTTAGAAGCCC
                      ____________________________________________________________
consensus TGGATTTGAACGAGACACCAATAATGCAGAATAATAGACTTCTGTCAAGGTTAGAAGCCC
 
. : . : . : . : . : . :
rJMSF005B20+ TCTCAAAGACAG
rJMSF035A14+ TCTCAAAGACAGTGGAGCTGGGCCGACGTTATTTTCCCAATTGCTCTCTAGTTCTGGATA
                      ____________________________________________________________
consensus TCTCAAAGACAGTGGAGCTGGGCCGACGTTATTTTCCCAATTGCTCTCTAGTTCTGGATA
 
. : . : . : . : . : . :
rJMSF035A14+ AGTTCATGGAGGATGACTTGCCTGATCTATTCTACCTAGAGAAGGGCACTTCAGAGGAGC
                      ____________________________________________________________
consensus AGTTCATGGAGGATGACTTGCCTGATCTATTCTACCTAGAGAAGGGCACTTCAGAGGAGC
 
. : . : . : . : . : . :
rJMSF035A14+ AAAAAATTAAGAGGAAGCGATTTAAAGAGCTCAAAGATGATGTCCAAAGGGCATTCAACA
                      ____________________________________________________________
consensus AAAAAATTAAGAGGAAGCGATTTAAAGAGCTCAAAGATGATGTCCAAAGGGCATTCAACA
 
. : . : . : . : . : . :
rJMSF035A14+ AGGACAAGGCTGAAAATCGTTGCTCTGGTTTGTCTTCATCATCGTCTTGCAATTCTCTGA
                      ____________________________________________________________
consensus AGGACAAGGCTGAAAATCGTTGCTCTGGTTTGTCTTCATCATCGTCTTGCAATTCTCTGA
 
. : . : . : . : . : . :
rJMSF035A14+ AAGACCATATGAGTTATAAATTTAGGAAAATGTGAAAGTATATAGTGGATCCACTCTCAC
                      ____________________________________________________________
consensus AAGACCATATGAGTTATAAATTTAGGAAAATGTGAAAGTATATAGTGGATCCACTCTCAC
 
. : . : . : . : . : . :
rJMSF035A14+ AAGTACACAGTTTTGAATGGAGAATATGTTGTCCTCAAAACTCTCATGTAAAAGGAAAAT
                      ____________________________________________________________
consensus AAGTACACAGTTTTGAATGGAGAATATGTTGTCCTCAAAACTCTCATGTAAAAGGAAAAT