Previous Contig 012959:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035A05Sequence658012959 (2)gb:AY099584_15766102e-47Arabidopsis thaliana glyoxalase II isozyme, putative (At1g06130) mRNA, complete
JMSF036M19Sequence680019915gb:AY099584_15766103e-77Arabidopsis thaliana glyoxalase II isozyme, putative (At1g06130) mRNA, complete 556012959 (2)pir|F86196|F861964e-30hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889630 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036M19+ GGCAAGCNGTTTGAAGGAACTCCTGATCA
rJMSF035A05+ ACGGGAGACACTTTGTTTAGCTTATCATGTGGCAAGCTGTTTGAAGGAACTCCTGATCA
                      ____________________________________________________________
consensus ACGGGAGACACTTTGTTTAGCTTATCATGTGGCAAGCTGTTTGAAGGAACTCCTGATCA
 
. : . : . : . : . : . :
rJMSF036M19+ GANGCNTGCTTNCCTGAGGAAGGATTATGTTGTTACCCAATGATACAAATATNTATTGTG
rJMSF035A05+ GATGCTTGCTTCCCTGAGGAA-GATTATGTTGTTACCCAATGATACAAATATCTATTGTG
                      ____________________________________________________________
consensus GATGCTTGCTTCCCTGAGGAAGGATTATGTTGTTACCCAATGATACAAATATCTATTGTG
 
. : . : . : . : . : . :
rJMSF036M19+ GCCATGNGTATNCTTTGAGTAATTCGAAGTTCGCACTTTCAATAGAACNTGGAAATCAAG
rJMSF035A05+ GCCATGAGTATACTTTGAGTAATTCGAAGTTCGCACTTTCAATAGAACCTGGAAATCAAG
                      ____________________________________________________________
consensus GCCATGAGTATACTTTGAGTAATTCGAAGTTCGCACTTTCAATAGAACCTGGAAATCAAG
 
. : . : . : . : . : . :
rJMSF036M19+ AGTTGCAATCTTATGCTGCCCAGATCNCCAATCTTNGCAAGAAGGGCTTACCCACAATNC
rJMSF035A05+ AGTTGCAATCTTATGCTGCCCAGATCACCAATCTTCGCAAGAAGGGCTTACCCACAATAC
                      ____________________________________________________________
consensus AGTTGCAATCTTATGCTGCCCAGATCACCAATCTTCGCAAGAAGGGCTTACCCACAATAC
 
. : . : . : . : . : . :
rJMSF036M19+ CAACAACCCTTGAGAAGGAGAAGNTATGCAATCCATTCCTACGGACTTTCAGTATGGAGA
rJMSF035A05+ CAACAACCCTTGAGAAGGAGAAGCTATGCAATCCATTCGTACGGACTTTCAGTATGGAGA
                      ____________________________________________________________
consensus CAACAACCCTTGAGAAGGAGAAGCTATGCAATCCATTCGTACGGACTTTCAGTATGGAGA
 
. : . : . : . : . : . :
rJMSF036M19+ TCAGGAAATCGTTAAACATTCCAGACTNTGNGGATGATGNTGAAGCTTTGAAGGCTNTCC
rJMSF035A05+ TCAGGAAATCGTTAAACATTCCAGACTCTGCGGATGATGCTGAAGCTNTGAAGGCTATCC
                      ____________________________________________________________
consensus TCAGGAAATCGTTAAACATTCCAGACTCTGCGGATGATGCTGAAGCTTTGAAGGCTATCC
 
. : . : . : . : . : . :
rJMSF036M19+ GNCAAGCTAAGGATAACTTTTAGTATATGCTTNGGATTNTTCAGCAACTGTCAAAGTCTC
rJMSF035A05+ GCCAAGCTAAGGATAACTTTTNGTATATGCTTTGGATTCTTCAGCAACTGTCAAAGTNTC
                      ____________________________________________________________
consensus GCCAAGCTAAGGATAACTTTTAGTATATGCTTTGGATTCTTCAGCAACTGTCAAAGTCTC
 
. : . : . : . : . : . :
rJMSF036M19+ AAAGCTAGCTCAACTGCCACAGAAATATGAGCACGTTTGGCGTTTCGTGTCCCTTGCAAA
rJMSF035A05+ AAAGCTAGCTCAACTGCCACAGNAATATGAGCACGTTTGGCGTTTCGTGTCCCTTGCAAA
                      ____________________________________________________________
consensus AAAGCTAGCTCAACTGCCACAGAAATATGAGCACGTTTGGCGTTTCGTGTCCCTTGCAAA
 
. : . : . : . : . : . :
rJMSF036M19+ GCAAANGACTGTTGGATGTAANGTAGCTTTATGTGTATAGCAAATTTCTTCCAATTTCTC
rJMSF035A05+ GCAAAAGACTGTTGGATGTAATGTAGCTTTATGTGTATAGCAAATTTCTTCCAATTTCTC
                      ____________________________________________________________
consensus GCAAAAGACTGTTGGATGTAATGTAGCTTTATGTGTATAGCAAATTTCTTCCAATTTCTC
 
. : . : . : . : . : . :
rJMSF036M19+ CTGCAATAAAAGAAANCATANTTAGTGTNTGTCTACAAATCTACAAT
rJMSF035A05+ CTGCAATAAAAGAAAACATATTTAGTGTTTGTCTNCAAATCTACAATAGATCATCTGGTT
                      ____________________________________________________________
consensus CTGCAATAAAAGAAAACATATTTAGTGTTTGTCTACAAATCTACAATAGATCATCTGGTT
 
. : . : . : . : . : . :
rJMSF035A05+ AAATTTCTCATGTATGTTCTTNAACTGAACAGATAGTAGAGTTTAGTNGAAAGATACTGA
                      ____________________________________________________________
consensus AAATTTCTCATGTATGTTCTTNAACTGAACAGATAGTAGAGTTTAGTNGAAAGATACTGA