Previous Contig 012948:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015G20Sequence613012948 (4)gb:AF180143_17748028e-64Glycine max ubiquitin carrier protein 4 (UBC4) mRNA, complete cds.630020999sp|P16577|UBC4_WHEAT0.009Ubiquitin-conjugating enzyme E2-23 kDa (EC 6.3.2.19) (Ubiquitin- protein ligase)
JMSF034M19Sequence615012948 (4)gb:AF180143_17748026e-69Glycine max ubiquitin carrier protein 4 (UBC4) mRNA, complete cds.616012948 (4)sp|P16577|UBC4_WHEAT9e-44Ubiquitin-conjugating enzyme E2-23 kDa (EC 6.3.2.19) (Ubiquitin- protein ligase)
JMSF048E02Sequence578012948 (4)sp|P16577|UBC4_WHEAT6e-47Ubiquitin-conjugating enzyme E2-23 kDa (EC 6.3.2.19) (Ubiquitin- protein ligase)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015G20- GTCACTCTTCTCTTCCTTTCCTTGTCTTCTCCCTCATCTAAT
JMSF034M19- TTCTCCCTCATCTAAT
                      ____________________________________________________________
consensus GTCACTCTTCTCTTCCTTTCCTTGTCTTCTCCCTCATCTAAT
 
. : . : . : . : . : . :
JMFF015G20- TAATTTCTCCTTTCTCCCTTCTTCTTCTTATCTTCTTCCCCCCCTTTTCTTGGTTTTTCC
JMSF034M19- TAATTTCTCCTTTCTCCCTTCTTCTTCTTATCTTCTTCCCCCCCTTTTCTTGGTTTTTCC
                      ____________________________________________________________
consensus TAATTTCTCCTTTCTCCCTTCTTCTTCTTATCTTCTTCCCCCCCTTTTCTTGGTTTTTCC
 
. : . : . : . : . : . :
JMFF015G20- TTGCTTTTCGATTACTTACCAAAAATCAAACTCGAATCTTAGTCGATCCCCTCATACCCT
JMSF034M19- TTGCTTTTCGATTACTTACCAAAAATCAAACTCGAATCTTAGTCGATCCCCTCATACCCT
                      ____________________________________________________________
consensus TTGCTTTTCGATTACTTACCAAAAATCAAACTCGAATCTTAGTCGATCCCCTCATACCCT
 
. : . : . : . : . : . :
JMFF015G20- TCGTCTCACAGTAAACATACAACATTTTCAAGAATGTCGTCTCCAAGTAAGAGGAGGGAT
JMSF034M19- TCGTCTCACAGTAAACATACAACATTTTCAAGAATGTCGTCTCCAAGTAAGAGGAGGGAT
                      ____________________________________________________________
consensus TCGTCTCACAGTAAACATACAACATTTTCAAGAATGTCGTCTCCAAGTAAGAGGAGGGAT
 
. : . : . : . : . : . :
JMFF015G20- ATGGATGTTATGAAATTGATGATGAGTGATTACACAGTGGAGCCAATAAACGATGAAATC
JMSF034M19- ATGGATGTTATGAAATTGATGATGAGTGATTACACAGTGGAGCCAATAAACGATGAAATC
                      ____________________________________________________________
consensus ATGGATGTTATGAAATTGATGATGAGTGATTACACAGTGGAGCCAATAAACGATGAAATC
 
. : . : . : . : . : . :
JMFF015G20- AACAAGTTCAATGTCGAATTCCATGGTCCAAAAGAAAGCCTTTATGAAGGTGGAGTCTGG
JMSF034M19- AACAAGTTCAATGTCGAATTCCATGGTCCAAAAGAAAGCCTTTATGAAGGTGGAGTCTGG
rJMSF048E02+ TCCAAAAGAAAGCNNTTATGAAGGCGGAGTCTGG
                      ____________________________________________________________
consensus AACAAGTTCAATGTCGAATTCCATGGTCCAAAAGAAAGCCTTTATGAAGGTGGAGTCTGG
 
. : . : . : . : . : . :
JMFF015G20- AAAGTTCGTGTGGAGCTTCCAGATGCTTATCCTTACAAGTCTCCTTCCATTGGGTTTCTA
JMSF034M19- AAAGTTCGTGTGGAGCTTCCAGATGCTTATCCTTACAAGTCTCCTTCCATTGGGTTTCTA
rJMSF048E02+ AAAGTTCGTGTGGAGCTTCCAGATGCTTATCCTTACAAGTCTCCTTCCATCGGGTTTCTA
rJMSF034M19+ TTCCATTGGGTTTCTA
                      ____________________________________________________________
consensus AAAGTTCGTGTGGAGCTTCCAGATGCTTATCCTTACAAGTCTCCTTCCATTGGGTTTCTA
 
. : . : . : . : . : . :
JMFF015G20- AACAAAATATTCCACCCAAATGTTGATGAACTGTCCGGTTCTGTATGTTTGGATGTCATC
JMSF034M19- AACAAAATATTCCACCCAAATGTTGATGAACTGTCCGGTTCTGTATGTTTGGATGTCATC
rJMSF048E02+ AACAAAATATTCCACCCAAATGTTGATGAACTGTCCGGTTNTGTATGTTTGGATGTCATC
rJMSF034M19+ AACAAAATATTCCACCCAAATGTTGATGAACTGTCCGGTTCTGTATGTTTGGATGTCATC
                      ____________________________________________________________
consensus AACAAAATATTCCACCCAAATGTTGATGAACTGTCCGGTTCTGTATGTTTGGATGTCATC
 
. : . : . : . : . : . :
JMFF015G20- AACCAGTCATGGAGTCCAATGTTTGATCTTTTAAATGTCTTTGAGGTTTTCCTCCCTCAA
JMSF034M19- AACCAGTCATGGAGTCCAATGTTTGATCTTTTAAATGTCTTTGAGGTTTTCCTCCCTCAA
rJMSF048E02+ AACCAGTCATGGAGTCAAATGNTTGATCTTTTAAANGTCTTTGAGGTTTTCNTCCCTCAA
rJMSF034M19+ AACCAGTCATGGAGTCCAATGTTTGATCTTTTAAATGTCTTTGAGGTTTTCCTCCCTCAA
                      ____________________________________________________________
consensus AACCAGTCATGGAGTCCAATGTTTGATCTTTTAAATGTCTTTGAGGTTTTCCTCCCTCAA
 
. : . : . : . : . : . :
JMFF015G20- CTCCTGCTTTACCCGAATCCATCAGACCCCTTGAATGGCGATGCAGCATCACTGATGATG
JMSF034M19- CTCCTGCTTTACCCGAATCCATCAGACCCCTTGAATGGCGATGCAGCATCACTGATGATG
rJMSF048E02+ CTCCTGCNTTACCNGANTCCATCAGACCCCNTGAANGGCGANGCAGCATCCNTGATGATG
rJMSF034M19+ CTCCTGCTTTACCCGAATCCATCAGACCCCTTGAATGGCGATGCAGCATCACTGATGATG
                      ____________________________________________________________
consensus CTCCTGCTTTACCCGAATCCATCAGACCCCTTGAATGGCGATGCAGCATCACTGATGATG
 
. : . : . : . : . : . :
JMFF015G20- AAGGACAAGAAGCAATATGACCAAAAAGTG
JMSF034M19- AAGGACAAGAAGCAATATGACCAAAAAGTGAAAGAGTATTGTGAGCGGTATGCAA
rJMSF048E02+ AANGACAAGNAGCNATNTGNCCAAAAAGTGAAAGAGTATTGTGAGCGGTATGCAAAGAAG
rJMSF034M19+ AAGGACAAGAAGCAATATGACCAAAAAGTGAAAGAGTATTGTGAGCGGTATGCAAAGAAG
                      ____________________________________________________________
consensus AAGGACAAGAAGCAATATGACCAAAAAGTGAAAGAGTATTGTGAGCGGTATGCAAAGAAG
 
. : . : . : . : . : . :
rJMSF048E02+ GAAAACATCAGCACACAGAAAGAAGAGAGCGATGAGGAGCTTAGTGNTGNGTATCTTAGT
rJMSF034M19+ GAAAACATCAGCACACAGAAAGAAGAGAGCGATGAGGAGCTTAGTGATGAGTATCTTAGT
                      ____________________________________________________________
consensus GAAAACATCAGCACACAGAAAGAAGAGAGCGATGAGGAGCTTAGTGATGAGTATCTTAGT
 
. : . : . : . : . : . :
rJMSF048E02+ GGGCAANNTGATAGCGAAGATGANGTTGCTGGACNCGCAGACCCGTAATGGANTGGCGNG
rJMSF034M19+ GGGCAAAGTGATAGCGAAGATGAAGTTGCTGGACATGCAGACCCGTAATGGAATGGCGTG
                      ____________________________________________________________
consensus GGGCAAAGTGATAGCGAAGATGAAGTTGCTGGACATGCAGACCCGTAATGGAATGGCGTG
 
. : . : . : . : . : . :
rJMSF048E02+ GATTTGAATAAGCTGTTATTTCCATGCCGCAGGTTCATTCAACCCCTTTANTGTATTACT
rJMSF034M19+ GATTTGAATAAGATGTTATTTCCATGCCGCAGGTTCATTCAACCCCTTTATTGTATTACT
                      ____________________________________________________________
consensus GATTTGAATAAGCTGTTATTTCCATGCCGCAGGTTCATTCAACCCCTTTATTGTATTACT
 
. : . : . : . : . : . :
rJMSF048E02+ ACATTCTNATGTANATCTAGGACATGNTCACAGGGGCATAGTCTTTC
rJMSF034M19+ ACATTCTTATGTAAATCTAGGACATGATCACAGGGGCATAGTCTTTCTTAGTGAATCAGT
                      ____________________________________________________________
consensus ACATTCTTATGTAAATCTAGGACATGATCACAGGGGCATAGTCTTTCTTAGTGAATCAGT
 
. : . : . : . : . : . :
rJMSF034M19+ TCTTGTTACTTAAGATGATCAAAAGATGAACTGTTTTAGAATGAAAATGGTAACAGTGTT
                      ____________________________________________________________
consensus TCTTGTTACTTAAGATGATCAAAAGATGAACTGTTTTAGAATGAAAATGGTAACAGTGTT
 
. : . : . : . : . : . :
rJMSF034M19+ TAAATTGTCTGTAACTCTGCCAACTGGATATGCAAAGGGTAATGTAAGTATCTGACTTTT
                      ____________________________________________________________
consensus TAAATTGTCTGTAACTCTGCCAACTGGATATGCAAAGGGTAATGTAAGTATCTGACTTTT