Previous Contig 012945:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005E05Sequence513006961 (3)pir|T08449|T084494e-27hypothetical protein F22O6.120 - Arabidopsis thaliana>gb:ATF22O6_1549707 Arabido723012945 (2)gb:AY057589_15640021e-53Arabidopsis thaliana AT3g52500/F22O6_120 mRNA, complete cds.
JMSF034L07Sequence622006961 (3)pir|T08449|T084492e-35hypothetical protein F22O6.120 - Arabidopsis thaliana>gb:ATF22O6_1549707 Arabido690012945 (2)gb:AY057589_15640024e-52Arabidopsis thaliana AT3g52500/F22O6_120 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005E05+ CAGCGGCAAAAG
                      ____________________________________________________________
consensus CAGCGGCAAAAG
 
. : . : . : . : . : . :
rJMFF005E05+ CAGCCCGTTAGTTATGGAGACCGGCGAAGATTCCGGCGATAAAATCGGGAACCTGAGCCG
rJMSF034L07+ TTCCGGCGATAAAATCGGGAACCTGAGCCG
                      ____________________________________________________________
consensus CAGCCCGTTAGTTATGGAGACCGGCGAAGATTCCGGCGATAAAATCGGGAACCTGAGCCG
 
. : . : . : . : . : . :
rJMFF005E05+ TACGCCGTTGCTGAAAAACCCTCAGGTGGCCGGCAGAGACGCATTGTCGGTGTATTACTA
rJMSF034L07+ TACGCCGTTGCTGAAAAACCCTCAGGTGGCCGGCAGAGACGCATTGTCGGTGTATTACTA
                      ____________________________________________________________
consensus TACGCCGTTGCTGAAAAACCCTCAGGTGGCCGGCAGAGACGCATTGTCGGTGTATTACTA
 
. : . : . : . : . : . :
rJMFF005E05+ CGTTAGCCTGAGGAAAATCACTGTCGGAGCCCAAAAACTGAAGATCCCATACAAGTACCT
rJMSF034L07+ CGTTAGCCTGAGGAAAATCACTGTCGGAGCCCAAAAACTGAAGATCCCATACAAGTACCT
                      ____________________________________________________________
consensus CGTTAGCCTGAGGAAAATCACTGTCGGAGCCCAAAAACTGAAGATCCCATACAAGTACCT
 
. : . : . : . : . : . :
rJMFF005E05+ CTCGCCGGATTCACAGGGCAACGGCGGCGCAATCGTGGATTCCGGCACGACCTTCACGTT
rJMSF034L07+ CTCGCCGGATTCACAGGGCAACGGCGGCGCAATCGTGGATTCCGGCACGACCTTCACGTT
                      ____________________________________________________________
consensus CTCGCCGGATTCACAGGGCAACGGCGGCGCAATCGTGGATTCCGGCACGACCTTCACGTT
 
. : . : . : . : . : . :
rJMFF005E05+ CTTGACCCACGACGTATTCCAGCTCGTCCAGAACGCGTTCCTCACTCAAGTCAAAACCTA
rJMSF034L07+ CTTGACCCACGACGTATTCCAGCTCGTCCAGAACGCGTTCCTCACTCAAGTCAAAACCTA
                      ____________________________________________________________
consensus CTTGACCCACGACGTATTCCAGCTCGTCCAGAACGCGTTCCTCACTCAAGTCAAAACCTA
 
. : . : . : . : . : . :
rJMFF005E05+ CCCGCGAGCCGGAAAACTGGAGAGCATTACCGGGCTGCGCCCGTGCTTCAATATCTCCGG
rJMSF034L07+ CCCGCGAGCCGGAAAACTGGAGAGCATTACCGGGCTGCGCCCGTGCTTCAATATCTCCGG
                      ____________________________________________________________
consensus CCCGCGAGCCGGAAAACTGGAGAGCATTACCGGGCTGCGCCCGTGCTTCAATATCTCCGG
 
. : . : . : . : . : . :
rJMFF005E05+ CCACCGCACAATAGACATGCCGGATATGAAGTTCCATTTCAAGGGAGGCGCAGAAATGGC
rJMSF034L07+ CCACCGCACAATAGACATGCCGGATATGAAGTTCCATTTCAAGGGAGGCGCAGAAATGGC
                      ____________________________________________________________
consensus CCACCGCACAATAGACATGCCGGATATGAAGTTCCATTTCAAGGGAGGCGCAGAAATGGC
 
. : . : . : . : . : . :
rJMFF005E05+ GCTGCCACTGGCAAACTACTTCACCATTGTCGGAACTGATAGCGTCTGCTTGACTCTGGT
rJMSF034L07+ GCTGCCACTGGCAAACTACTTCACCATTGTCGGAACTGATAGCGTCTGCTTGACTCTGGT
                      ____________________________________________________________
consensus GCTGCCACTGGCAAACTACTTCACCATTGTCGGAACTGATAGCGTCTGCTTGACTCTGGT
 
. : . : . : . : . : . :
rJMFF005E05+ GACGGACAGCTTCGGCCCGGAGTTGCCCGCCGGACCGGCGATCATTCTGGGGAATTTCCA
rJMSF034L07+ GACGGACAGCTTCGGCCCGGAGTTGCCCGCCGGACCGGCGATCATTCGGGGGAATTTCCA
                      ____________________________________________________________
consensus GACGGACAGCTTCGGCCCGGAGTTGCCCGCCGGACCGGCGATCATTCTGGGGAATTTCCA
 
. : . : . : . : . : . :
rJMFF005E05+ GATGCAGAATTTCTACGTGGAGTATGATCTGAAGAATGAGAAGTTGGGATTCCGGCGACA
rJMSF034L07+ GATGCAGAATTTCTACGTGGAGTATGATCTGAAGAATGAGAAGTTGGGATTCCGGCGACA
                      ____________________________________________________________
consensus GATGCAGAATTTCTACGTGGAGTATGATCTGAAGAATGAGAAGTTGGGATTCCGGCGACA
 
. : . : . : . : . : . :
rJMFF005E05+ ATTATGCAAGTGATTCTGGAATTTTTTTTTTAAAAAAAGTTTAGGGGTCCAAACCAAATT
rJMSF034L07+ ATTATGCAAGTGATTCTGGAATTTTTTTTTTAAAAAAAGTTTAGGGGTCCAAACCAAATT
                      ____________________________________________________________
consensus ATTATGCAAGTGATTCTGGAATTTTTTTTTTAAAAAAAGTTTAGGGGTCCAAACCAAATT
 
. : . : . : . : . : . :
rJMFF005E05+ ATGCAATTTCTTAGCCTTGTTGTTGTAAATTTTATTTTTTATTT
rJMSF034L07+ ATGCAATTTCTTAGCCTTGTTGTTGTAAATTTTATTTTTTATTTTGAAAAATTACATTTT
                      ____________________________________________________________
consensus ATGCAATTTCTTAGCCTTGTTGTTGTAAATTTTATTTTTTATTTTGAAAAATTACATTTT