Previous Contig 012935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009O11Sequence269012935 (8)718012935 (8)gb:AC016163_15381181e-60Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.
JMSF026E08Sequence643012935 (8)gb:AC016163_15381184e-53Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.750012935 (8)gb:AC016163_15381181e-60Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.
JMSF034H11Sequence621012935 (8)gb:AC016163_15381184e-53Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.718012935 (8)gb:AC016163_15381181e-60Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.
JMSF053K15Sequence663012935 (8)gb:AC016163_15381184e-53Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.742012935 (8)gb:AC016163_15381182e-60Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009O11- GGGCGGTTATTATTCGCGCCATT
JMSF053K15- GGTTATTATTCGCGCCATT
                      ____________________________________________________________
consensus GGGCGGTTATTATTCGCGCCATT
 
. : . : . : . : . : . :
JMSF009O11- GGGTTCACCCTCGAGAAGGTTCAGCTATGGCGATGCTGACGACTTCCGTCCCATCTTTCT
JMSF034H11- AGCTATGGCGATGCTGACGACTTCCGTCCCATCTTTCT
JMSF026E08- GTTCACCCTCGAGAAGGTTCAGCTATGGCGATGCTGACGACTTCCGTCCCATCTTTCT
JMSF053K15- GGGTTCACCCTCGAGAAGGTTCAGCTATGGCGATGCTGACGACTTCCGTCCCATCTTTCT
                      ____________________________________________________________
consensus GGGTTCACCCTCGAGAAGGTTCAGCTATGGCGATGCTGACGACTTCCGTCCCATCTTTCT
 
. : . : . : . : . : . :
JMSF009O11- CCCTTCGTCCTCCCAAAGCAAACCTCTCCACTACTGCCGGCGGTGGCGGTTTTTTTCCCC
JMSF034H11- CCCTTCGTCCTCCCAAAGCAAACCTCTCCACTACTGCCGGCGGTGGCGGTTTTTTTCCCC
JMSF026E08- CCCTTCGTCCTCCCAAAGCAAACCTCTCCACTACTGCCGGCGGTGGCGGTTTTTTTCCCC
JMSF053K15- CCCTTCGTCCTCCCAAAGCAAACCTCTCCACTACTGCCGGCGGTGGCGGTTTTTTTCCCC
rJMSF026E08+ CAAAGCAAACCTCTCCACTACTGCCGGCGGTGGCGGTTTTTTTCCCC
rJMSF009O11+ CC
rJMSF053K15+ CGGCGGTGGCGGTTTTTTTCCCC
                      ____________________________________________________________
consensus CCCTTCGTCCTCCCAAAGCAAACCTCTCCACTACTGCCGGCGGTGGCGGTTTTTTTCCCC
 
. : . : . : . : . : . :
JMSF009O11- GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
JMSF034H11- GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
JMSF026E08- GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
JMSF053K15- GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
rJMSF026E08+ GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
rJMSF009O11+ GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
rJMSF053K15+ GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGNTAAGTCGATTGTGCGGTACCGCA
rJMSF034H11+ TGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
                      ____________________________________________________________
consensus GTGCTGATAGAGCCGGCGAGTTCTGCCGTCCAGTAGCTAAGTCGATTGTGCGGTACCGCA
 
. : . : . : . : . : . :
JMSF009O11- ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
JMSF034H11- ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
JMSF026E08- ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
JMSF053K15- ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
rJMSF026E08+ ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
rJMSF009O11+ ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
rJMSF053K15+ ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTNTACTGCTCCTACTATCATCACTG
rJMSF034H11+ ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
                      ____________________________________________________________
consensus ATCAGGGGGCGGTGCTAACCCCCGCTTCCTCTGTGTCTACTGCTCCTACTATCATCACTG
 
. : . : . : . : . : . :
JMSF009O11- ATGAGT
JMSF034H11- ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
JMSF026E08- ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
JMSF053K15- ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
rJMSF026E08+ ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
rJMSF009O11+ ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
rJMSF053K15+ ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
rJMSF034H11+ ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
                      ____________________________________________________________
consensus ATGAGTTGGAATCGGCGTCGAGCGTGGTGAGGAAATTCTACTCTGGTATCAATGGCCGCG
 
. : . : . : . : . : . :
JMSF034H11- ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
JMSF026E08- ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
JMSF053K15- ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
rJMSF026E08+ ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
rJMSF009O11+ ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
rJMSF053K15+ ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
rJMSF034H11+ ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
                      ____________________________________________________________
consensus ACTTGGCCTCGGTTGAAGGCCTTATAGCTGAGAATTGTGTATATGAAGATCTCGTATTCC
 
. : . : . : . : . : . :
JMSF034H11- CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
JMSF026E08- CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
JMSF053K15- CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
rJMSF026E08+ CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
rJMSF009O11+ CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
rJMSF053K15+ CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
rJMSF034H11+ CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
                      ____________________________________________________________
consensus CTCAGCCCTTTGTTGGACGCAAGGCCATTCTAGAATTTTTTAGGAAGTTTATTGATTCTG
 
. : . : . : . : . : . :
JMSF034H11- TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
JMSF026E08- TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
JMSF053K15- TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
rJMSF026E08+ TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
rJMSF009O11+ TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
rJMSF053K15+ TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
rJMSF034H11+ TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
                      ____________________________________________________________
consensus TTGGGCCTGATCTGCAATTTGTGATTGATGATATATCAGAGGAGGATTCCTCAGCTGTAG
 
. : . : . : . : . : . :
JMSF034H11- GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
JMSF026E08- GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
JMSF053K15- GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
rJMSF026E08+ GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
rJMSF009O11+ GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
rJMSF053K15+ GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
rJMSF034H11+ GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
                      ____________________________________________________________
consensus GGGTCACATGGCACTTAGAATGGAAGGGAAGGCCATTTCCTTTTAGCAAAGGATGTAGCT
 
. : . : . : . : . : . :
JMSF034H11- TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
JMSF026E08- TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
JMSF053K15- TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
rJMSF026E08+ TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
rJMSF009O11+ TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
rJMSF053K15+ TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
rJMSF034H11+ TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
                      ____________________________________________________________
consensus TTTATCGGTTGGAAGCAGTAGATGGCCAGAGGCAAATACTATATGGTAGAGACAGTGTTG
 
. : . : . : . : . : . :
JMSF034H11- AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCA
JMSF026E08- AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCA
JMSF053K15- AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCAG
rJMSF026E08+ AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCAGAGGCGTAGCTTGGCTGC
rJMSF009O11+ AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCAGAGGCGTAGCTTGGCTGC
rJMSF053K15+ AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCAGAGGCGTAGCTTGGCTGC
rJMSF034H11+ AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCAGAGGCGTAGCTTGGCTGC
                      ____________________________________________________________
consensus AACCTGCAATCAAGCCTGGAGAGACAGCTTTGGTTGCTATCAGAGGCGTAGCTTGGCTGC
 
. : . : . : . : . : . :
rJMSF026E08+ TGCAACAGTTTCCGCAATTGGCAGAACGGCTATAATGGAAACATCGAATCTTATATAAAC
rJMSF009O11+ TGCAACAGTTTCCGCAATTGGCAGAACGGCTATAATGGAAACATCGAATCTTATATAAAC
rJMSF053K15+ TGCAACAGTTTCCGCAATTGGCAGAACGGCTATAATGGAAACATCGAATCTTATATAAAC
rJMSF034H11+ TGCAACAGTTTCCGCAATTGGCAGAACGGCTATAATGGAAACATCGAATCTTATATAAAC
                      ____________________________________________________________
consensus TGCAACAGTTTCCGCAATTGGCAGAACGGCTATAATGGAAACATCGAATCTTATATAAAC
 
. : . : . : . : . : . :
rJMSF026E08+ TCTTGCAGGTAGGCAAAACCTGCTAAATATAGTGGACTTGTGAAGGAAATGATGCTACAT
rJMSF009O11+ TCTTGCAGGTAGGCAAAACCTGCTAAATATGGTGGACTTGTGAAGGAAATGATGCTACAT
rJMSF053K15+ TCTTGCAGGTAGGCAAAACCTGCTAAATATGGTGGACTTGTGAAGGAAATGATGCTACAT
rJMSF034H11+ TCTTGCAGGTAGGCAAAACCTGCTAAATATGGTGGACTTGTGAAGGAAATGATGCTACAT
                      ____________________________________________________________
consensus TCTTGCAGGTAGGCAAAACCTGCTAAATATGGTGGACTTGTGAAGGAAATGATGCTACAT
 
. : . : . : . : . : . :
rJMSF026E08+ A-CTAGCTAATATTTGTTGTAAAATTATTAATCAGAAATCAGAA
rJMSF009O11+ A-CTAGCTAATATTTGTTGTAAAATTATTAATCAGAAATCAGAATAATGAAATTTGT
rJMSF053K15+ ANCTAGCTAATATTTGTTGTAAAATTATTAATCAGAAATCAGAATAATGAAATTTGT
rJMSF034H11+ A-CTAGCTAATATTTGTTGTAAAATTATTAATCAGAAATCAGAATAATGAAATTTGTACA
                      ____________________________________________________________
consensus A-CTAGCTAATATTTGTTGTAAAATTATTAATCAGAAATCAGAATAATGAAATTTGTACA