Previous Contig 012931:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007G03Sequence283004880 (3)700012931 (3)pir|A84829|A848298e-56hypothetical protein At2g40400 [imported] - Arabidopsis thaliana>gb:AC007020_153
JMSF016B20Sequence260004880 (3)805012931 (3)gb:AY093111_15750651e-75Arabidopsis thaliana putative protein (At3g56140) mRNA, complete cds.>gb:BT01034
JMSF034F14Sequence547002150 (50)gb:AP004268_18394834e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P004645012931 (3)pir|A84829|A848293e-45hypothetical protein At2g40400 [imported] - Arabidopsis thaliana>gb:AC007020_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016B20+ ACAGTATGAAAGCGTAAA
                      ____________________________________________________________
consensus ACAGTATGAAAGCGTAAA
 
. : . : . : . : . : . :
rJMSF016B20+ GAAAANTTTTGGAAGAGANTGACTATGTTATAACAGATACTGTCAGAGGAACTGTCGTAG
                      ____________________________________________________________
consensus GAAAANTTTTGGAAGAGANTGACTATGTTATAACAGATACTGTCAGAGGAACTGTCGTAG
 
. : . : . : . : . : . :
rJMSF016B20+ ACTTTTTTACGGTGTGGCTTCCCGCCCCCACGATTTCTTTCCTACCTGCAGCCAGCGATG
                      ____________________________________________________________
consensus ACTTTTTTACGGTGTGGCTTCCCGCCCCCACGATTTCTTTCCTACCTGCAGCCAGCGATG
 
. : . : . : . : . : . :
rJMSF016B20+ CTAACATGCCCGAAAGCATCGAAGCGTTAAAGGGTCTCCTCGGTTCCATCCCGGATAATG
rJMSF007G03+ CATCGAAGCGTTAAAGGGTCTCCTCGGTTNCATCCCGGATAATG
                      ____________________________________________________________
consensus CTAACATGCCCGAAAGCATCGAAGCGTTAAAGGGTCTCCTCGGTTCCATCCCGGATAATG
 
. : . : . : . : . : . :
rJMSF016B20+ CGTTTCAAAAAAGCATTGCAGGGAAGGACTGGGGATTGAGCCACCGAGTTGCGTCAGTCA
rJMSF007G03+ CGTTTCAAAAAAGCATTGCAGGGAAGGACTGGGGATTGAGCCACCGAGTTGCGTCAGTCA
                      ____________________________________________________________
consensus CGTTTCAAAAAAGCATTGCAGGGAAGGACTGGGGATTGAGCCACCGAGTTGCGTCAGTCA
 
. : . : . : . : . : . :
rJMSF016B20+ TTGTTGGCGGTCTTAAACTCGCCAGCGTTGGATTCATTTCGAGTATCGGAGCAGTGACTT
rJMSF007G03+ TTGTNGGCGGTCTTAAACTCGCCAGCGTTGGATTCATTTCGAGTATCGGAGCAGTGACTT
                      ____________________________________________________________
consensus TTGTTGGCGGTCTTAAACTCGCCAGCGTTGGATTCATTTCGAGTATCGGAGCAGTGACTT
 
. : . : . : . : . : . :
rJMSF016B20+ CTTCCAATATCTTGTTTGGAATGCGTAAGATAATAAACCCGACTCTTGCTAATAAGACGC
rJMSF007G03+ CTTCCAATATCTTGTTTGGAATGCGTAAGATAATAAACCCGACTCTTGNTAATAAGACGC
                      ____________________________________________________________
consensus CTTCCAATATCTTGTTTGGAATGCGTAAGATAATAAACCCGACTCTTGCTAATAAGACGC
 
. : . : . : . : . : . :
rJMSF016B20+ AACAAAACAAAAGATCTCCCGTTCTGAAAACAGCGCTCGTGTATGGAGGCTTTCTTGGAA
rJMSF007G03+ AACAAAACAAAAGATCTCCCGTTCTGAAAACAGCGCTCGTGTATGGAGGCTTTCTTGGAA
rJMSF034F14+ TTTCTTGGAA
                      ____________________________________________________________
consensus AACAAAACAAAAGATCTCCCGTTCTGAAAACAGCGCTCGTGTATGGAGGCTTTCTTGGAA
 
. : . : . : . : . : . :
rJMSF016B20+ CATCAGCAAATCTTCGGTATCAGATTATTGCAGGAATTATAGAGCACCGGATTTCTGACC
rJMSF007G03+ CATCAGCAAATCTTCGGTATCAGATTATTGCAGGAATTATAGAGCACCGGATTTCTGACC
rJMSF034F14+ CATCAGCAAATCTTCGGTATCAGATTATTGCAGGAATTATAGAGCACCGGATTTCTGACC
                      ____________________________________________________________
consensus CATCAGCAAATCTTCGGTATCAGATTATTGCAGGAATTATAGAGCACCGGATTTCTGACC
 
. : . : . : . : . : . :
rJMSF016B20+ AATTCTCCGACCAGACATTACTCGTAAATATGCTGTCTTTTGTTGCTCGTACGATCAACT
rJMSF007G03+ AATTCTCCGACCAGACATTACTNGTAAATATGCTGTCTTTTGTTGCTCGTACGATCAACT
rJMSF034F14+ AATTCTCCGACCAGACATTACTCGTAAATATGCTGTCTTTTGTTGCTCGTACGATCAACT
                      ____________________________________________________________
consensus AATTCTCCGACCAGACATTACTCGTAAATATGCTGTCTTTTGTTGCTCGTACGATCAACT
 
. : . : . : . : . : . :
rJMSF016B20+ CATACTGGGGCACCCAGCAATGGATAGATCTTGCGCGGTTTACAGG
rJMSF007G03+ CATACTGGGGCACCCAGCAATGGATAGATCTTGCGCGGTTTACAGGGNTGCAACCACGCC
rJMSF034F14+ CATACTGGGGCACCCAGCAATGGATAGATCTTGCGCGGTTTACAGGGCTGCAACCACGCC
                      ____________________________________________________________
consensus CATACTGGGGCACCCAGCAATGGATAGATCTTGCGCGGTTTACAGGGCTGCAACCACGCC
 
. : . : . : . : . : . :
rJMSF007G03+ AACCACCACGAAAGACTGAACCCGACTCCCAGCTTACTCCAGATTCTGCAAATCGCACTG
rJMSF034F14+ AACCACCACGAAAGACTGAACCCGACTCCCAGCTTACTCCAGATTCTGCAAATCGCACTG
                      ____________________________________________________________
consensus AACCACCACGAAAGACTGAACCCGACTCCCAGCTTACTCCAGATTCTGCAAATCGCACTG
 
. : . : . : . : . : . :
rJMSF007G03+ CAGTCGAATGCAGCCCCATGGATGATACACATACAGATGAAAGAAATGAAACCAACAACC
rJMSF034F14+ CAGTCGAATGCAGCCCCATGGATGATACACATACAGATGAAAGAAATGAAACCAACAACC
                      ____________________________________________________________
consensus CAGTCGAATGCAGCCCCATGGATGATACACATACAGATGAAAGAAATGAAACCAACAACC
 
. : . : . : . : . : . :
rJMSF007G03+ AGTAGTTCCATTTTTTTTAGGTTTTCTAGCGCCATAATCTGTAGTTTTTGATTGTTTTGT
rJMSF034F14+ AGTAGTTCCATTTTTTTTAGGTTTTCTAGCGCCATAATCTGTAGTTTTTGATTGTTTTGT
                      ____________________________________________________________
consensus AGTAGTTCCATTTTTTTTAGGTTTTCTAGCGCCATAATCTGTAGTTTTTGATTGTTTTGT
 
. : . : . : . : . : . :
rJMSF007G03+ TGTATAGTGTTTACCTGTGATATGAAATTNATAGACTTGTAGTTTTCTCAGAATTT
rJMSF034F14+ TGTATAGTGTTTACCTGTGATATGAAATTTATAGACTTGTAGTTTTCTCAGAATTTGAAG
                      ____________________________________________________________
consensus TGTATAGTGTTTACCTGTGATATGAAATTTATAGACTTGTAGTTTTCTCAGAATTTGAAG