Previous Contig 012928:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF034E22Sequence687007955 (3)gb:AY093113_15750672e-69Arabidopsis thaliana unknown protein (At4g31390) mRNA, complete cds.>gb:BT008424571012928 (2)gb:AY093113_15750674e-50Arabidopsis thaliana unknown protein (At4g31390) mRNA, complete cds.>gb:BT008424
JMSF049O21Sequence689007955 (3)gb:AY093113_15750673e-43Arabidopsis thaliana unknown protein (At4g31390) mRNA, complete cds.>gb:BT008424663012928 (2)gb:AY093113_15750677e-72Arabidopsis thaliana unknown protein (At4g31390) mRNA, complete cds.>gb:BT008424

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049O21+ GTATCCCAGAGAGGTTTTCTCNTGTTATTCG
                      ____________________________________________________________
consensus GTATCCCAGAGAGGTTTTCTCNTGTTATTCG
 
. : . : . : . : . : . :
rJMSF049O21+ TTCTCTATTGACTCAAGAAGGCATCTGTTTGACATTGGAGCCAGGTTTCAAATTTCTTGA
                      ____________________________________________________________
consensus TTCTCTATTGACTCAAGAAGGCATCTGTTTGACATTGGAGCCAGGTTTCAAATTTCTTGA
 
. : . : . : . : . : . :
rJMSF049O21+ GGTTGCGTATCCTTATGTTGCGAAGCGCCTTCTTACAGATCCTAACCCTGCTTTACGGGA
rJMSF034E22+ TTACAGATCCTAACCCTGCTTTACGGGA
                      ____________________________________________________________
consensus GGTTGCGTATCCTTATGTTGCGAAGCGCCTTCTTACAGATCCTAACCCTGCTTTACGGGA
 
. : . : . : . : . : . :
rJMSF049O21+ ACGCCTTATACAGGTTTTATTCAAGGATGGTGTNTTCCNGTGGAAACGGCTCGAGAATNT
rJMSF034E22+ ACGCCTTATACAGGTTTTATTCAAGGATGGTGTCTTCCAGTGGAAACGGCTCGAGAATTT
                      ____________________________________________________________
consensus ACGCCTTATACAGGTTTTATTCAAGGATGGTGTCTTCCAGTGGAAACGGCTCGAGAATTT
 
. : . : . : . : . : . :
rJMSF049O21+ AATAGTTCTTGCCAAGGAAAACGTGGCAAAGATGAGCAGCAACCCTGCNTTGAGAGGGAA
rJMSF034E22+ AATAGTTCTTGCCAAGGAAAACGTGGCAAAGATGAGCAGCAACCCTGCNTTGAGAGGGAA
                      ____________________________________________________________
consensus AATAGTTCTTGCCAAGGAAAACGTGGCAAAGATGAGCAGCAACCCTGCNTTGAGAGGGAA
 
. : . : . : . : . : . :
rJMSF049O21+ TGGCAGCGTACAAAAGTACAAAGACGTTAGAGTTGAACGAAGGTTGGATNTGACNGACNC
rJMSF034E22+ TGGCAGCGTACAAAAGTACAAAGACGTTAGAGTTGAACGAAGGTTGGATTTGACNGACNC
                      ____________________________________________________________
consensus TGGCAGCGTACAAAAGTACAAAGACGTTAGAGTTGAACGAAGGTTGGATTTGACNGACNC
 
. : . : . : . : . : . :
rJMSF049O21+ AATCAAGGATGGAGCTCGAGTGTTCCTTCTGGATGAAGGCNTTCGCNGGAAGCTTNTTCT
rJMSF034E22+ NATCAAGGATGGAGCTCGAGTGTTCCTTNTGGATGAAGGCNTTCGCNGGAAGCTTNTTNT
                      ____________________________________________________________
consensus AATCAAGGATGGAGCTCGAGTGTTCCTTCTGGATGAAGGCNTTCGCNGGAAGCTTNTTCT
 
. : . : . : . : . : . :
rJMSF049O21+ TGCTCTCNCTGAAGACTNTAAACTTCACGTTCAAGAGCTTGTGGATGTATACCGATTGCT
rJMSF034E22+ TGCTNTCNCTGAAGACTNTAAACTTCACGTTCAAGAGCTTGTGGATGTATACCGATTGCT
                      ____________________________________________________________
consensus TGCTCTCNCTGAAGACTNTAAACTTCACGTTCAAGAGCTTGTGGATGTATACCGATTGCT
 
. : . : . : . : . : . :
rJMSF049O21+ TGAAGACCAAATTGACATACCTTCNGTAGCAAGGGAAGTTGTTGAAGATNTTCCNTCCCT
rJMSF034E22+ TGAAGACCAAATTGACATACCTTCNGTAGCAAGGGAAGTTGTTGAAGATNTTCCNTCCCT
                      ____________________________________________________________
consensus TGAAGACCAAATTGACATACCTTCNGTAGCAAGGGAAGTTGTTGAAGATNTTCCNTCCCT
 
. : . : . : . : . : . :
rJMSF049O21+ TGCTCGTGATGTCATGCTCTCATGGAGCAACTCCGTGTTATCGGACNGATAAGAATATAA
rJMSF034E22+ TGCTCGNGATGTCATGCTCTCATGGAGCAACTCCGTGTTATNGGACNGATAAGAATATAA
                      ____________________________________________________________
consensus TGCTCGTGATGTCATGCTCTCATGGAGCAACTCCGTGTTATCGGACNGATAAGAATATAA
 
. : . : . : . : . : . :
rJMSF049O21+ GATGCCNTGCTGCNTTGCTTTGCTGCTGTACNGAAGTAATATTTACAAAAACCNTTTTTT
rJMSF034E22+ GATGCCNTGCTGCNTTGCTTTGCTGCTGTACNGAAGTAATATTTACAAAAACCNTTTTTT
                      ____________________________________________________________
consensus GATGCCNTGCTGCNTTGCTTTGCTGCTGTACNGAAGTAATATTTACAAAAACCNTTTTTT
 
. : . : . : . : . : . :
rJMSF049O21+ TTTTGTCTTTCTTGTTTGGTTAATAAGCTGAC
rJMSF034E22+ TTTTGTCTTTCTTGTTTGGTTAATAAGCTGACTACTACAACATTACATACATCAAAAAAT
                      ____________________________________________________________
consensus TTTTGTCTTTCTTGTTTGGTTAATAAGCTGACTACTACAACATTACATACATCAAAAAAT