Previous Contig 012920:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005E09Sequence466005754 (3)pir|T48403|T484034e-66hypothetical protein F17C15.180 - Arabidopsis thaliana>gb:AB005235_1509357 Arabi527012920 (3)gb:AF432499_17995045e-10Oryza sativa cellulose synthase-like protein OsCslA9 gene, complete cds.>gb:AP00
JMSF018G24Sequence276005754 (3)gb:AB006699_15098913e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDJ22.>gb:AY058158_1564773012920 (3)gb:AF432499_17995047e-44Oryza sativa cellulose synthase-like protein OsCslA9 gene, complete cds.>gb:AP00
JMSF034B20Sequence691005754 (3)pir|T48403|T484038e-77hypothetical protein F17C15.180 - Arabidopsis thaliana>gb:AB005235_1509357 Arabi691012920 (3)gb:AF432499_17995041e-20Oryza sativa cellulose synthase-like protein OsCslA9 gene, complete cds.>gb:AP00

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018G24+ ACTATCCTCCATAGNGTCGGCACTCCGAGGTCATTTCACTTGTTGTCGTT
                      ____________________________________________________________
consensus ACTATCCTCCATAGNGTCGGCACTCCGAGGTCATTTCACTTGTTGTCGTT
 
. : . : . : . : . : . :
rJMSF018G24+ CTGGCTGCTGTTTGAGAATGTTATGGCACTACATCGGACAAAGGGAACCTTAATAGGATT
                      ____________________________________________________________
consensus CTGGCTGCTGTTTGAGAATGTTATGGCACTACATCGGACAAAGGGAACCTTAATAGGATT
 
. : . : . : . : . : . :
rJMSF018G24+ GATGGAGGTGGGTAGGGTGAACGAGTGGATTGTGACAGAGAAATTAGGCGATGCTTTCAA
rJMSF034B20+ GATTGTGACAGAGAAATTAGGCGATGCTTTCAA
                      ____________________________________________________________
consensus GATGGAGGTGGGTAGGGTGAACGAGTGGATTGTGACAGAGAAATTAGGCGATGCTTTCAA
 
. : . : . : . : . : . :
rJMSF018G24+ ATTAAAATCGGCTGCACAAGCCATTAAAACACCACGTTTCAAGATTGCAGAAAGAGTGCT
rJMSF034B20+ ATTAAAATCGGCTGCACAAGCCATTAAAACACCACGTTTCAAGATTGCAGAAAGAGTGCT
                      ____________________________________________________________
consensus ATTAAAATCGGCTGCACAAGCCATTAAAACACCACGTTTCAAGATTGCAGAAAGAGTGCT
 
. : . : . : . : . : . :
rJMSF005E09+ CTATGTTTTGGGGCATATCTCTTGTTTTGCGGCTGCTATGACCTTATATT
rJMSF018G24+ TGTTTTAGAGCTATGTTTTGGGGCATATCTCTTGTTTTGCGGCTGCTATGACCTTATATT
rJMSF034B20+ TGTTTTAGAGCTATGTTTTGGGGCATATCTCTTGTTTTGCGGCTGCTATGACCTTATATT
                      ____________________________________________________________
consensus TGTTTTAGAGCTATGTTTTGGGGCATATCTCTTGTTTTGCGGCTGCTATGACCTTATATT
 
. : . : . : . : . : . :
rJMSF005E09+ TGGGAAGCAATTGTATTATTGGTACATCATACTTCAAGCCATCGCATTCTTTATAATCGG
rJMSF018G24+ TGGGAAGCAATTGTATTATTGGTACATCATACTTCAAGCCATCGCATTCTTTATAATCGG
rJMSF034B20+ TGGGAAGCAATTGTATTATTGGTACATCATACTTCAAGCCATCGCATTCTTTATAATCGG
                      ____________________________________________________________
consensus TGGGAAGCAATTGTATTATTGGTACATCATACTTCAAGCCATCGCATTCTTTATAATCGG
 
. : . : . : . : . : . :
rJMSF005E09+ ATTCGGATATGTGGGCACCATTGTTCCCTCCTAGCTCCTAGCTCCTAGCTCCTAGCTCCA
rJMSF018G24+ ATTCGGATATGTGGGCACCATTGTTCCCTCCTAGCTCCTAGCTCCTAGCTCCTAGCTCCA
rJMSF034B20+ ATTCGGATATGTGGGCACCATTGTTCCCTCCTAGCTCCTAGCTCCTAGCTCCTAGCTCCA
                      ____________________________________________________________
consensus ATTCGGATATGTGGGCACCATTGTTCCCTCCTAGCTCCTAGCTCCTAGCTCCTAGCTCCA
 
. : . : . : . : . : . :
rJMSF005E09+ ACCAAACACGCCCTTAGGCCACTCCTTGTTGGTTTCCAAAAACAATTTGGGTGCTTGCAT
rJMSF018G24+ ACCAAACACGCCCTTAGGCCACTCCTTGTTGGTTTCCAAAAACAATTTGGGTGCTTGCAT
rJMSF034B20+ ACCAAACACGCCCTTAGGCCACTCCTTGTTGGTTTCCAAAAACAATTTGGGTGCTTGCAT
                      ____________________________________________________________
consensus ACCAAACACGCCCTTAGGCCACTCCTTGTTGGTTTCCAAAAACAATTTGGGTGCTTGCAT
 
. : . : . : . : . : . :
rJMSF005E09+ GCATGCATGGTGGATTCTTTATGGCTCAAATGGATTCATTCAATTGNGTAGAGATTTGAA
rJMSF018G24+ GCATGCATGGTGGATTCTTTATGGCTCAAATGGATTCATTCAATTGTGTAGAGATTTGAA
rJMSF034B20+ GCATGCATGGTGGATTCTTTATGGCTCAAATGGATTCATTCAATTGTGTAGAGATTTGAA
                      ____________________________________________________________
consensus GCATGCATGGTGGATTCTTTATGGCTCAAATGGATTCATTCAATTGTGTAGAGATTTGAA
 
. : . : . : . : . : . :
rJMSF005E09+ TTCAAGATTAAAGGGAATATAGAGAGGGAAATTCAAGGAAAGATGGAATGTGTTCTTTTG
rJMSF018G24+ TTCAAGATTAAAGGGAATATAGAGAGGGAAATTCAAGGAAAGATGGAATGTGTTCTTTTG
rJMSF034B20+ TTCAAGATTAAAGGGAATATAGAGAGGGAAATTCAAGGAAAGATGGAATGTGTTCTTTTG
                      ____________________________________________________________
consensus TTCAAGATTAAAGGGAATATAGAGAGGGAAATTCAAGGAAAGATGGAATGTGTTCTTTTG
 
. : . : . : . : . : . :
rJMSF005E09+ AGAAGGGAAAAGCAAAAAGGAAAGTGGATGGAGAAATAGGACTCTCTTAGCTTGCTTCCA
rJMSF018G24+ AGAAGGGAAAAGCAAAAAGGAAAGTGGATGGAGAAATAGGACTCTCTTAGCTTGCTTCCA
rJMSF034B20+ AGAAGGGAAAAGCAAAAAGGAAAGTGGATGGAGA--TAGGACTCTCTTAGCTTGCTTCCA
                      ____________________________________________________________
consensus AGAAGGGAAAAGCAAAAAGGAAAGTGGATGGAGAAATAGGACTCTCTTAGCTTGCTTCCA
 
. : . : . : . : . : . :
rJMSF005E09+ TGNCACATAGTTTGTGTAGTGATAGTAACTTAAATGCATCTCTTTCATTTGCCTNTTCCT
rJMSF018G24+ TGGCACATAGTTTGTGTAGTGATAGTAACTTAAATGCATCTCTTTCATTTGCCTTTTCCT
rJMSF034B20+ TGGCACATAGTTTGTGTAGTGATAGTAACTTAAATGCATCTCTTTCATTTGCCTTTTCCT
                      ____________________________________________________________
consensus TGGCACATAGTTTGTGTAGTGATAGTAACTTAAATGCATCTCTTTCATTTGCCTTTTCCT
 
. : . : . : . : . : . :
rJMSF005E09+ TCTCTTTCGTATTCCAATAAAATTGTGTAAAATATTGTTGCNTAGCTCATTCATATT
rJMSF018G24+ TCTCTTTTGTATTCCAATAAAATTGTGTAAAATATTGTTGCTTAGCTCATTCATATT
rJMSF034B20+ TCTCTTTTGTATTCCAATAAAATTGTGTAAAATATTGTTGCTTAGCTCATTCATATTGTT
                      ____________________________________________________________
consensus TCTCTTTTGTATTCCAATAAAATTGTGTAAAATATTGTTGCTTAGCTCATTCATATTGTT
 
. : . : . : . : . : . :
rJMSF034B20+ TTAATAGACTCAATAATGAAATCAAGTATAGTCGAGATAGAATTTATTGTCAACTTGTAT
                      ____________________________________________________________
consensus TTAATAGACTCAATAATGAAATCAAGTATAGTCGAGATAGAATTTATTGTCAACTTGTAT