Previous Contig 012918:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007K04Sequence395012918 (4)gb:OSJN00105_16949960.011Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02, complete seque415012918 (4)gb:AY087437_15724681e-24Arabidopsis thaliana clone 35440 mRNA, complete sequence.
JMSF034A12Sequence683012918 (4)gb:AB020742_15145741e-38Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:BT003079_163668012918 (4)gb:AB020742_15145742e-44Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:BT003079_163

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007K04- AGATTCCCACTGTGACAGAACTCAGTGATAACCCAGTGAGTCAA
JMSF034A12- GCCAGATTCCCACTGTGACAGAACTCAGTGATAACCCAGTGAGTCAA
                      ____________________________________________________________
consensus GCCAGATTCCCACTGTGACAGAACTCAGTGATAACCCAGTGAGTCAA
 
. : . : . : . : . : . :
JMSF007K04- CTCGTGTTGCAGCTAGTCAGCAACTCAGCATCCACTTTCCCTGTGAAGAAAATGAAGGCC
JMSF034A12- CTCGTGTTGCAGCTAGTCAGCAACTCAGCATCCACTTTCCCTGTGAAGAAAATGAAGGCC
                      ____________________________________________________________
consensus CTCGTGTTGCAGCTAGTCAGCAACTCAGCATCCACTTTCCCTGTGAAGAAAATGAAGGCC
 
. : . : . : . : . : . :
JMSF007K04- GGAATTACTAAGCTCATAGTTCTCCACCCACCGGCGGTGCCGGCATCATCTCCTCGTGTT
JMSF034A12- GGAATTACTAAGCTCATAGTTCTCCACCCACCGGCGGTGCCGGCATCATCTCCTCGTGTT
                      ____________________________________________________________
consensus GGAATTACTAAGCTCATAGTTCTCCACCCACCGGCGGTGCCGGCATCATCTCCTCGTGTT
 
. : . : . : . : . : . :
JMSF007K04- CTGCTTCTGGGCTTCATCTCATTCTTCGCTTTGGCTTCTGCCCTCACTTTCTTCTCCGCC
JMSF034A12- CTGCTTCTGGGCTTCATCTCATTCTTCGCTTTGGCTTCTGCCCTCACTTTCTTCTCCGCC
                      ____________________________________________________________
consensus CTGCTTCTGGGCTTCATCTCATTCTTCGCTTTGGCTTCTGCCCTCACTTTCTTCTCCGCC
 
. : . : . : . : . : . :
JMSF007K04- AAAGACGCCGTTGAGGGAGGGGGAAAGCCTCCGGCGGGAATACCCCAGCCGGTGTTGGAA
JMSF034A12- AAAGACGCCGTTGAGGGAGGGGGAAAGCCTCCGGCGGGAATACCCCAGCCGGTGTTGGAA
                      ____________________________________________________________
consensus AAAGACGCCGTTGAGGGAGGGGGAAAGCCTCCGGCGGGAATACCCCAGCCGGTGTTGGAA
 
. : . : . : . : . : . :
JMSF007K04- GCGCTTGTGCATTACGCCGCCGTGGCGAACACCACCTATCTGTCCTCCCGAATGTCCTCC
JMSF034A12- GCGCTTGTGCATTACGCCGCCGTGGCGAACACCACCTATCTGTCCTCCCGAATGTCCTCC
                      ____________________________________________________________
consensus GCGCTTGTGCATTACGCCGCCGTGGCGAACACCACCTATCTGTCCTCCCGAATGTCCTCC
 
. : . : . : . : . : . :
JMSF007K04- GCGGAAGTGGGCGCCGTGGCGGCTGCCCTCCGCCGCTGCGGAAACGCCTG
JMSF034A12- GCGGAAGTGGGCGCCGTGGCGGCTGCCCTCCGCCGCTGCGGAAACGCCTGCAACTTCCTT
                      ____________________________________________________________
consensus GCGGAAGTGGGCGCCGTGGCGGCTGCCCTCCGCCGCTGCGGAAACGCCTGCAACTTCCTT
 
. : . : . : . : . : . :
JMSF034A12- GTTTTCGGGCTGAGCCACGAGACCCTCCTCTGGCATTCGCTGAACCACGGCGGGCGGACG
rJMSF034A12+ CGGGCGGACG
                      ____________________________________________________________
consensus GTTTTCGGGCTGAGCCACGAGACCCTCCTCTGGCATTCGCTGAACCACGGCGGGCGGACG
 
. : . : . : . : . : . :
JMSF034A12- GTGTTCGTGGACGAGAGCGCGTACATGGTGGCGAAAGCGGAGGAGAAGCACCGCGGGATT
rJMSF034A12+ GTGTTCGTGGACGAGAGCGCGTACATGGTGGCGAAAGCGGAGGAGAAGCNCCGCGGGATT
                      ____________________________________________________________
consensus GTGTTCGTGGACGAGAGCGCGTACATGGTGGCGAAAGCGGAGGAGAAGCACCGCGGGATT
 
. : . : . : . : . : . :
JMSF034A12- GAAGCGTACGACATTCAGTTCACCACCAAAGCCGCCCAATTGTATCATCTCTTGGAGCAC
rJMSF034A12+ GAAGCGTACGACATTCAGTTCACCACCAAAGCCGCCCAATTGTATCATCTCTTGGAGCAC
                      ____________________________________________________________
consensus GAAGCGTACGACATTCAGTTCACCACCAAAGCCGCCCAATTGTATCATCTCTTGGAGCAC
 
. : . : . : . : . : . :
JMSF034A12- GCCAAGGAACGTGGCATGAAAGAGTGCCGGCCGGTGCAGAATCTGCTCTTCTCCGACTGC
rJMSF007K04+ ACTGC
rJMSF034A12+ GCCAAGGAACGTGGCATGAAAGAGTGCCGGCCGGTGCAGAATNTGCTNTTNTCCGACTGC
                      ____________________________________________________________
consensus GCCAAGGAACGTGGCATGAAAGAGTGCCGGCCGGTGCAGAATCTGCTCTTCTCCGACTGC
 
. : . : . : . : . : . :
JMSF034A12- AAGTTGGCCGTCAACGACCTCCCGAACCACATATAC
rJMSF007K04+ AAGTTGGCCGTCAACGNCCTCCCGAACCNCATATACGACGTCGCNTGGGACGTGATCTTG
rJMSF034A12+ AAGTTGGCCGTCAACGACCTCCCGAACCACATATACGACGTCGCTTGGGACGTGATCTTG
                      ____________________________________________________________
consensus AAGTTGGCCGTCAACGACCTCCCGAACCACATATACGACGTCGCTTGGGACGTGATCTTG
 
. : . : . : . : . : . :
rJMSF007K04+ GTNGACGGGCCNCGGGGGTACGCGCCGTCGTCGCCGGGGAGAATGTNGGNGATATTCNCC
rJMSF034A12+ GTGGACGGGCCGCGGGGGTACGCGCCGTCGTCGCCGGGGAGAATGTNGGCGATATTCACC
                      ____________________________________________________________
consensus GTGGACGGGCCGCGGGGGTACGCGCCGTCGTCGCCGGGGAGAATGTNGGCGATATTCACC
 
. : . : . : . : . : . :
rJMSF007K04+ GCCGGCGTNCTGGCCNGGAGCAAGGTGGGCGGCGAGGCGGAAACGCAGGTGTTTGTGCNC
rJMSF034A12+ GCCGGCGTGCTGGCCNGGAGCAAGGTGGGCGGCGAGGCGGAAACGCAGGTGTTTGTGCNC
                      ____________________________________________________________
consensus GCCGGCGTGCTGGCCNGGAGCAAGGTGGGCGGCGAGGCGGAAACGCAGGTGTTTGTGCNC
 
. : . : . : . : . : . :
rJMSF007K04+ GAGATTGGGAGAGAGGTTGAAAGAGTGAGCNGTGAGAGATTTCTTTGCAATGCCAATTTG
rJMSF034A12+ GAGATTGGGAGAGAGGTTGAAAGAGTGAGCNGTGAGAGATTTCTNTGCAATGCCAATTTG
                      ____________________________________________________________
consensus GAGATTGGGAGAGAGGTTGAAAGAGTGAGCNGTGAGAGATTTCTTTGCAATGCCAATTTG
 
. : . : . : . : . : . :
rJMSF007K04+ GTAGATTTGGTGGANGCTTTGGGGCNTTTTNCGGTGACCAAAATGGACGCTGCCAATTTC
rJMSF034A12+ GTAGATTTGGTGGATGCTTTGGGGCNTTTTGCGGTGACCNAAATGGACGCTGCCAATTTC
                      ____________________________________________________________
consensus GTAGATTTGGTGGATGCTTTGGGGCNTTTTGCGGTGACCAAAATGGACGCTGCCAATTTC
 
. : . : . : . : . : . :
rJMSF007K04+ AGATTTTGCTCTCCNTTAATGGCAGATGAGTGAAGAACTGAAGTGANGTCATAATTTCCA
rJMSF034A12+ AGATTTTGCTCTCCNTTAATGGCNGATGAGTGAAGAACTGAAGTGATGTCATAATTTCCN
                      ____________________________________________________________
consensus AGATTTTGCTCTCCNTTAATGGCAGATGAGTGAAGAACTGAAGTGATGTCATAATTTCCA
 
. : . : . : . : . : . :
rJMSF007K04+ CTTTTTTTNAAAAATATATACTTTTTGCTTTGAATATATAGCCAAATCGA
rJMSF034A12+ CTTTTTTTAAAAAATATATA-TTTTTG-TTAGAATATATAGCCAAATCGATCTGTAATGT
                      ____________________________________________________________
consensus CTTTTTTTAAAAAATATATACTTTTTGCTTTGAATATATAGCCAAATCGATCTGTAATGT
 
. : . : . : . : . : . :
rJMSF034A12+ GTTTATTGTCTTTAAAAAAAAAAGTGAGAACCAAATGTTATCTAAATATTCACAATTTAT
                      ____________________________________________________________
consensus GTTTATTGTCTTTAAAAAAAAAAGTGAGAACCAAATGTTATCTAAATATTCACAATTTAT