Previous Contig 012916:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003J19Sequence322007219 (4)gb:AP004855_18460360.004Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15693012916 (6)gb:AP006149_18609462e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B127
JMSF034A02Sequence692012916 (6)pir|E86334|E863341e-84hypothetical protein T20H2.13 [imported] - Arabidopsis thaliana>gb:AE005172_8909708012916 (6)gb:AP006149_18609463e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B127
JMSF038H15Sequence659007219 (4)gb:AP004855_18460361e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15910012916 (6)pir|E86334|E863341e-91hypothetical protein T20H2.13 [imported] - Arabidopsis thaliana>gb:AE005172_8909
JMSF040G04Sequence145012916 (6)pir|E86334|E863342e-06hypothetical protein T20H2.13 [imported] - Arabidopsis thaliana>gb:AE005172_8909
JMSF048B21Sequence716007219 (4)gb:AP004855_18460364e-87Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15694012916 (6)gb:AP006149_18609461e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B127

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034A02- AATGGATCCTTCCAAGGCAAGCAAGAGGCCGGTTGG
                      ____________________________________________________________
consensus AATGGATCCTTCCAAGGCAAGCAAGAGGCCGGTTGG
 
. : . : . : . : . : . :
JMSF034A02- AATTCTTCATGTGAAGGTTGTGAAGGCAATGAATCTGAAGAAGAAAGATCTTTTGGGGTC
                      ____________________________________________________________
consensus AATTCTTCATGTGAAGGTTGTGAAGGCAATGAATCTGAAGAAGAAAGATCTTTTGGGGTC
 
. : . : . : . : . : . :
JMSF034A02- TTCAGATCCCTGTGTCAAACTCAAGCTTACTGAGGATAAACTTCCTAGAAAGAAAACGAG
rJMSF038H15+ GAAAGGAAACGAG
                      ____________________________________________________________
consensus TTCAGATCCCTGTGTCAAACTCAAGCTTACTGAGGATAAACTTCCTAGAAAGGAAACGAG
 
. : . : . : . : . : . :
JMSF034A02- TGTAAAGCAAAGAAACTTGAATCCCGAATGGAATGAGGAATTCAATTTTGTCGTTAAGGA
rJMSF038H15+ TGTAAAGCAAAGAAACTTGAATCCCGAATGGAATGAGGAATTCAATTTTGTCGTTAAGGA
                      ____________________________________________________________
consensus TGTAAAGCAAAGAAACTTGAATCCCGAATGGAATGAGGAATTCAATTTTGTCGTTAAGGA
 
. : . : . : . : . : . :
rJMSF040G04+ ATTTCTGTCTATGACTGGGAACCAGATTGGTACGAATG
JMSF034A02- TCCGCAATCCCAAGCTTTAGACATTTCTGTCTATGACTGGGAA-CAGATTGGTACGAATG
rJMSF038H15+ TCCGCAATCCCAAGCTTTAGACATTTCTGTCTATGACTGGGAA-CAGATTGGTACGAATG
                      ____________________________________________________________
consensus TCCGCAATCCCAAGCTTTAGACATTTCTGTCTATGACTGGGAA-CAGATTGGTACGAATG
 
. : . : . : . : . : . :
rJMSF040G04+ AAATGATGGGCATAAATATTGTTCCTTTGAAAGATCTTACTCCCGAAGAACCTAAAGTCC
JMSF034A02- AAATGATGGGCATAAATATTGTTCCTTTGAAAGATCTTACTCCCGAAGAACCTAAAGTCC
rJMSF038H15+ AAATGATGGGCATAAATATTGTTCCTTTGAAAGATCTTACTCCCGAAGAACCTAAAGTCC
                      ____________________________________________________________
consensus AAATGATGGGCATAAATATTGTTCCTTTGAAAGATCTTACTCCCGAAGAACCTAAAGTCC
 
. : . : . : . : . : . :
rJMSF040G04+ TGACGCTGAATCTTCTGAAAACCCTGGATCCAAATGAT
JMSF034A02- TGACGCTGAATCTTCTGAAAACCCTGGATCCAAATGATCCTATAAACGAGAAGTCGCGAG
rJMSF038H15+ TGACGCTGAATCTTCTGAAAACCCTGGATCCAAATGATCCTATAAACGAGAAGTCGCGAG
rJMSF048B21+ ATCCAAATGATCCTATAAACGAGAAGTCGCGAG
rJMSF003J19+ GGATCCAAATGATCCTATAAACGAGAAGTCGCGAG
rJMSF034A02+ TTCTGAAAACCCTGGATCCAAATGATCCTATAAACGAGAAGTCGCGAG
                      ____________________________________________________________
consensus TGACGCTGAATCTTCTGAAAACCCTGGATCCAAATGATCCTATAAACGAGAAGTCGCGAG
 
. : . : . : . : . : . :
JMSF034A02- GACAGATAGTTCTTGAAGTAATGTACAAGCCTTTTACAGACGAGGAAATGCCAAATGATG
rJMSF038H15+ GACAGATAGTTCTTGAAGTAATGTACAAGCCTTTTACAGACGAGGAAATGCCAAATGATG
rJMSF048B21+ GACAGATAGTTCTTGAAGTAATGTACAAGCCTTTTACAGACGAGGAAATGCCAAATGATG
rJMSF003J19+ GACAGATAGTTCTTGAAGTAATGTACAAGCCTTTTACAGACGAGGAAATGCCAAATGATG
rJMSF034A02+ GACAGATAGTTCTTGAAGTAATGTACAAGCCTTTTACAGACGAGGAAATGCCAAATGATG
                      ____________________________________________________________
consensus GACAGATAGTTCTTGAAGTAATGTACAAGCCTTTTACAGACGAGGAAATGCCAAATGATG
 
. : . : . : . : . : . :
JMSF034A02- TTGATGAGTCGGGAGGTGAAGTAGAGAAGGCTCCCGAAGGAACACCTGCCGGTGGTGGAT
rJMSF038H15+ TTGATGAGTCGGGAGGTGAAGTAGAGAAGGCTCCCGAAGGAACACCTGCCGGTGGTGGAT
rJMSF048B21+ TTGATGAATCGGGAGGTGAAGTAGAGAAGGCTCCCGAAGGAACACCTGCCGGTGGTGGAT
rJMSF003J19+ TTGATGAGTCGGGAGGTGAAGTAGAGAAGGCTCCCGAAGGAACACCTGCCGGTGGTGGAT
rJMSF034A02+ TTGATGAGTCGGGAGGTGAAGTAGAGAAGGCTCCCGAAGGAACACCTGCCGGTGGTGGAT
                      ____________________________________________________________
consensus TTGATGAGTCGGGAGGTGAAGTAGAGAAGGCTCCCGAAGGAACACCTGCCGGTGGTGGAT
 
. : . : . : . : . : . :
JMSF034A02- TGCTAGTAGTCATCGTCCACGAAGCTCAGGACCTCGAAGGGAAGCACCACACAAATCCAT
rJMSF038H15+ TGCTAGTAGTCATCGTCCACGAAGCTCAGGACCTCGAAGGGAAGCACCACACAAATCCAT
rJMSF048B21+ TGCTAGTAGTCATCGTCCACGAAGCTCAGGACCTCGAAGGGAAGCACCACACAAATCCAT
rJMSF003J19+ TGCTAGTAGTCATCGTCCACGAAGCTCAGGACCTCGAAGGGAAGCACCACACAAATCCAT
rJMSF034A02+ TGCTAGTAGTCATCGTCCACGAAGCTCAGGACCTCGAAGGGAAGCACCACACAAATCCAT
                      ____________________________________________________________
consensus TGCTAGTAGTCATCGTCCACGAAGCTCAGGACCTCGAAGGGAAGCACCACACAAATCCAT
 
. : . : . : . : . : . :
JMSF034A02- TCGTTCGTTTGCTCTTCAAAGGAGAGGAGAAAAAAACTAAGACTGTCAAGAAAAACCGAG
rJMSF038H15+ TCGTTCGTTTGCTCTTCAAAGGAGAGGAGAAAAAAACTAAGACTGTCAAGAAAAACCGAG
rJMSF048B21+ TCGTTCGTTTGCTCTTCAAAGGAGAGGAGAAAAAAACTAAGACTGTCAAGAAAAACCGAG
rJMSF003J19+ TCGTTCGTTTGCTCTTCAAAGGAGAGGAGAAAAAAACTAAGACTGTCAAGAAAAACCGAG
rJMSF034A02+ TCGTTCGTTTGCTCTTCAAAGGAGAGGAGAAAAAAACTAAGACTGTCAAGAAAAACCGAG
                      ____________________________________________________________
consensus TCGTTCGTTTGCTCTTCAAAGGAGAGGAGAAAAAAACTAAGACTGTCAAGAAAAACCGAG
 
. : . : . : . : . : . :
JMSF034A02- ATCCTAGATGGGGAGAGGACTTTCAGTTCATGTTGGAGGAGCCACCTACTAATGAAA
rJMSF038H15+ ATCCTAGATGGGGAGAGGACTTTCAGTTCATGTTGGAGGAGCCACCTACTAATGAAAGGC
rJMSF048B21+ ATCCTAGATGGGGAGAGGACTTTCAGTTCATGTTGGAGGAGCCACCTACTAATGAAAGGC
rJMSF003J19+ ATCCTAGATGGGGAGAGGACTTTCAGTTCATGTTGGAGGAGCCACCTACTAATGAAAGGC
rJMSF034A02+ ATCCTAGATGGGGAGAGGACTTTCAGTTCATGTTGGAGGAGCCACCTACTAATGAAAGGC
                      ____________________________________________________________
consensus ATCCTAGATGGGGAGAGGACTTTCAGTTCATGTTGGAGGAGCCACCTACTAATGAAAGGC
 
. : . : . : . : . : . :
rJMSF038H15+ TTCATGTCGAAGTTTTTAGCAACTCATCCAGAATAGGTCTGCTGCATCCTAAGGAGTCTC
rJMSF048B21+ TTCATGTCGAAGTTTTTAGCAACTCATCCAGAATAGGTCTGCTGCATCCTAAGGAGTCTC
rJMSF003J19+ TTCATGTCGAAGTTTTTAGCAACTCATCCAGAATAGGTCTGCTGCATCCTAAGGAGTCTC
rJMSF034A02+ TTCATGTCGAAGTTTTTAGCAACTCATCCAGAATAGGTCTGCTGCATCCTAAGGAGTCTC
                      ____________________________________________________________
consensus TTCATGTCGAAGTTTTTAGCAACTCATCCAGAATAGGTCTGCTGCATCCTAAGGAGTCTC
 
. : . : . : . : . : . :
rJMSF038H15+ TGGGATATGTGGATATAGCCCTGGCTGATGTAGTGAGCAATAAGAGAATCAATGAGCGAT
rJMSF048B21+ TGGGATATGTGGATATAGCCCTGGCTGATGTAGTGAGCAATAAGAGAATCAATGAGCGAT
rJMSF003J19+ TGGGATATGTGGATATAGCCCTGGCTGATGTAGTGAGCAATAAGAGAATCAATGAGCGAT
rJMSF034A02+ TGGGATATGTGGATATAGCCCTGGCTGATGTAGTGAGCAATAAGAGAATCAATGAGCGAT
                      ____________________________________________________________
consensus TGGGATATGTGGATATAGCCCTGGCTGATGTAGTGAGCAATAAGAGAATCAATGAGCGAT
 
. : . : . : . : . : . :
rJMSF038H15+ ACCACCTTATTGACTCCAAGAATGGTCGAATCCAGATTGAGCTACAATGGAGAACTGCAT
rJMSF048B21+ ACCACCTTATTGACTCCAAGAATGGTCGAATCCAGATTGAGCTACAATGGAGAACTGCAT
rJMSF003J19+ ACCACCTTATTGACTCCAAGAATGGTCGAATCCAGATTGAGCTACAATGGAGAACTGCAT
rJMSF034A02+ ACCACCTTATTGACTCCAAGAATGGTCGAATCCAGATTGAGCTACAATGGAGAACTGCAT
                      ____________________________________________________________
consensus ACCACCTTATTGACTCCAAGAATGGTCGAATCCAGATTGAGCTACAATGGAGAACTGCAT
 
. : . : . : . : . : . :
rJMSF038H15+ CAACTTGATCACAATTCTCCAGTACTATGTTGTACAACGCTGTAAAAATTCCTTAAAATT
rJMSF048B21+ CAACTTGATCACAATTCTCCAGTACTATGTTGTACAACGCTGTAAAAATTCCTTAAAATT
rJMSF003J19+ CAACTTGATCACAATTCTCCAGTACTATGTTGTACAACGCTGTAAAAATTCCTTAAAATT
rJMSF034A02+ CAACTTGATCACAATTCTCCAGTACTATGTTGTACAACGCTGTAAAAATTCCTTAAAATT
                      ____________________________________________________________
consensus CAACTTGATCACAATTCTCCAGTACTATGTTGTACAACGCTGTAAAAATTCCTTAAAATT
 
. : . : . : . : . : . :
rJMSF038H15+ TCATACCAACGTGTGTGTGCCAATGTTTCTTATTCTTTACTTTAATGTTTCTACTTTATG
rJMSF048B21+ TCATACCAACGTGTGTGTGCCAATGTTTCTTATTCTTTACTTTAATGTTTCTACTTTATG
rJMSF003J19+ TCATACCAACGTGTGTGTGCCAATGTTTCTTATTCTTTACTTTAATGTTTCTACTTTATG
rJMSF034A02+ TCATACCAACGTGTGTGTGCCAATGTTTCTTATTCTTTACTTTAATGTTTCTACTTTATG
                      ____________________________________________________________
consensus TCATACCAACGTGTGTGTGCCAATGTTTCTTATTCTTTACTTTAATGTTTCTACTTTATG
 
. : . : . : . : . : . :
rJMSF038H15+ AACTCATTCTTGTTGAGACATATAGCTGCTTGTTGTCTGTATAGGAAAA
rJMSF048B21+ AACTCATTCTTGTTGAGACATATAGCTGCTTGTTGTCTGTATAGGAAAA
rJMSF003J19+ AACTCATTCTTGTTGAGACATATAGCTGCTTGTTGTCTGTATAGGAAAAC
rJMSF034A02+ AACTCATTCTTGTTGAGACATATAGCTGCTTGTTGTCTGTATAGGAAAACCTGTGTATTG
                      ____________________________________________________________
consensus AACTCATTCTTGTTGAGACATATAGCTGCTTGTTGTCTGTATAGGAAAACCTGTGTATTG