Previous Contig 012915:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033P21Sequence662012915 (2)gb:AK176904_18188921e-63Arabidopsis thaliana mRNA for putative glycerate dehydrogenase, partial cds, clo710012915 (2)gb:AK176904_18188928e-72Arabidopsis thaliana mRNA for putative glycerate dehydrogenase, partial cds, clo

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033P21- GAATAGTTCTTGGTCCACCAATGGTGTTCAAAGAATACGGCCA
                      ____________________________________________________________
consensus GAATAGTTCTTGGTCCACCAATGGTGTTCAAAGAATACGGCCA
 
. : . : . : . : . : . :
JMSF033P21- CAAATTCGCCGACAAGTTCAGGCTTCTGAAGCCCTGGGAGTCGCCGCTACCGCTGGAAGA
                      ____________________________________________________________
consensus CAAATTCGCCGACAAGTTCAGGCTTCTGAAGCCCTGGGAGTCGCCGCTACCGCTGGAAGA
 
. : . : . : . : . : . :
JMSF033P21- GTTCCTCTCAGCCCACGCACAGACGGTCGAGGCTATGTTCTGCTCCGCCTCTGTACCTCT
                      ____________________________________________________________
consensus GTTCCTCTCAGCCCACGCACAGACGGTCGAGGCTATGTTCTGCTCCGCCTCTGTACCTCT
 
. : . : . : . : . : . :
JMSF033P21- CTCCGCCTCCCTCCTCACACACCTGCCTTCCCTCCGCTTCGTCGTCACCTCCAGCGCCGG
                      ____________________________________________________________
consensus CTCCGCCTCCCTCCTCACACACCTGCCTTCCCTCCGCTTCGTCGTCACCTCCAGCGCCGG
 
. : . : . : . : . : . :
JMSF033P21- CCTCGACCACATCGACCTCCGAGAGTGCCGCCGCTTAGGCATCGCCGTCGCCAACGCTGC
                      ____________________________________________________________
consensus CCTCGACCACATCGACCTCCGAGAGTGCCGCCGCTTAGGCATCGCCGTCGCCAACGCTGC
 
. : . : . : . : . : . :
JMSF033P21- CGACATTTTCTCCGCTGACGTCGGGGACCTCGCCGTCGGCTTGCTCATCGACGTCCTCAG
rJMSF033P21+ TCCGCTGACGTCGGGGACCTCGCCGTCGGCNTGCTCATCGACGTCCTCAG
                      ____________________________________________________________
consensus CGACATTTTCTCCGCTGACGTCGGGGACCTCGCCGTCGGCTTGCTCATCGACGTCCTCAG
 
. : . : . : . : . : . :
JMSF033P21- GAGAATCTCCGCCTCTCACCGTTTCGTTAAAACTAGGGCTTGGCCTATCAAACCTCATTA
rJMSF033P21+ GAGAATCTCCGCCTCTCACCGTTTCGTTAAAACTAGGGCTTGGCCTATCAAACCTCATTA
                      ____________________________________________________________
consensus GAGAATCTCCGCCTCTCACCGTTTCGTTAAAACTAGGGCTTGGCCTATCAAACCTCATTA
 
. : . : . : . : . : . :
JMSF033P21- TCCTCTCGCTTCCAAGGTGGGAGGCAAGCGGGTTGGGATTGTAGGACTGGGAAGCATAGG
rJMSF033P21+ TCCTCTCGCTTCCAAGGTGGGAGGCAAGCGGGTTGGGATTGTAGGACTGGGAAGCATAGG
                      ____________________________________________________________
consensus TCCTCTCGCTTCCAAGGTGGGAGGCAAGCGGGTTGGGATTGTAGGACTGGGAAGCATAGG
 
. : . : . : . : . : . :
JMSF033P21- GCAGCAAGTCGCAAAGAGGCTTGAGGCTTTTGGCTGCCCAATCTCATACTACTCGAGGAA
rJMSF033P21+ GCAGCAAGTCGCAAAGAGGCTTGAGGCTTTTGGCTGCCCAATCTCATACTACTCGAGGAA
                      ____________________________________________________________
consensus GCAGCAAGTCGCAAAGAGGCTTGAGGCTTTTGGCTGCCCAATCTCATACTACTCGAGGAA
 
. : . : . : . : . : . :
JMSF033P21- GGAGAAGCCATGGACCTCCTACTGCTTCTATGCTGATGTTCATGAACTAGCAACTGCGTC
rJMSF033P21+ GGAGAAGCCATGGACCTCCTACTGCTTCTATGCTGATGTTCATGAACTAGCAACTGCGTC
                      ____________________________________________________________
consensus GGAGAAGCCATGGACCTCCTACTGCTTCTATGCTGATGTTCATGAACTAGCAACTGCGTC
 
. : . : . : . : . : . :
JMSF033P21- TGATATCTTGGTGATTTGCTGTGCATTGACACAAGAAACCCATCACCTCATCAACAAACA
rJMSF033P21+ TGATATCTTGGTGATTTGCTGTGCATTGACACAAGAAACCCATCACCTCATCAACAAACA
                      ____________________________________________________________
consensus TGATATCTTGGTGATTTGCTGTGCATTGACACAAGAAACCCATCACCTCATCAACAAACA
 
. : . : . : . : . : . :
JMSF033P21- GGTTCTCCTGGCTTTGGGA
rJMSF033P21+ GGTTCTCCTGGCTTTGGGAAAGGAAGGAGTGATTGTTAACATTGCGCGGGGAGGGATAAT
                      ____________________________________________________________
consensus GGTTCTCCTGGCTTTGGGAAAGGAAGGAGTGATTGTTAACATTGCGCGGGGAGGGATAAT
 
. : . : . : . : . : . :
rJMSF033P21+ CGATGAGAAGGAATTGGTACAGTGTTTGTTGCAGGGAGAGATTGCAGGTGCTGGATTGGA
                      ____________________________________________________________
consensus CGATGAGAAGGAATTGGTACAGTGTTTGTTGCAGGGAGAGATTGCAGGTGCTGGATTGGA
 
. : . : . : . : . : . :
rJMSF033P21+ TGTTTTTGAACATGAACCTCATGTTCCTGAAGAGCTTCTTGGATTGGATTGTGTTGTCCT
                      ____________________________________________________________
consensus TGTTTTTGAACATGAACCTCATGTTCCTGAAGAGCTTCTTGGATTGGATTGTGTTGTCCT
 
. : . : . : . : . : . :
rJMSF033P21+ GTCTTCACACTCTGCTGTTCTCACACATGAATCCTTTAAACAAGTATATGAGCTTACTGT
                      ____________________________________________________________
consensus GTCTTCACACTCTGCTGTTCTCACACATGAATCCTTTAAACAAGTATATGAGCTTACTGT
 
. : . : . : . : . : . :
rJMSF033P21+ AGGGAATCTTGAGGCTTTCTTCTCCAATCAACCCCTGCTTTCTCCTGTTTTACATGAATA
                      ____________________________________________________________
consensus AGGGAATCTTGAGGCTTTCTTCTCCAATCAACCCCTGCTTTCTCCTGTTTTACATGAATA
 
. : . : . : . : . : . :
rJMSF033P21+ AATGTTTGTCATAGCCTTTATCAATTCATTTCTTCTGTTATGTATGCCAGCAGGCAGCTA
                      ____________________________________________________________
consensus AATGTTTGTCATAGCCTTTATCAATTCATTTCTTCTGTTATGTATGCCAGCAGGCAGCTA