Previous Contig 012913:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026C16Sequence628012913 (4)gb:AB005231_15092739e-37Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AY062523_1565
JMSF009N09Sequence161006911 (4)737012913 (4)gb:AB005231_15092731e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AY062523_1565
JMSF033N01Sequence609006911 (4)gb:AB005231_15092733e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AY062523_1565713012913 (4)gb:AB005231_15092732e-44Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AY062523_1565
JMSF037M06Sequence639006911 (4)gb:AB005231_15092734e-14Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AY062523_1565726012913 (4)gb:AB005231_15092737e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AY062523_1565

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037M06+ TGCAAAGGGTATTAACTGTAC
rJMSF009N09+ CGTAGGTTGGTTGCAAAGGGTATTAACTGTAC
                      ____________________________________________________________
consensus CGTAGGTTGGTTGCAAAGGGTATTAACTGTAC
 
. : . : . : . : . : . :
rJMSF037M06+ ATATACTCATATAAATGCGGTTTCCTACATTATGCATGAAGCTACTCGAGTATTTCTGGG
rJMSF009N09+ ATATACTCATATAAATGCGGTTTCCTACATTATGCATGAAGCTACTCGAGTATTTCTGGG
                      ____________________________________________________________
consensus ATATACTCATATAAATGCGGTTTCCTACATTATGCATGAAGCTACTCGAGTATTTCTGGG
 
. : . : . : . : . : . :
rJMSF037M06+ TGCCGCATCAATTTTGTCCAATGGAACTGTTTACTCAAGGGTTGGCACTGCATGTGTTGC
rJMSF009N09+ TGCCGCATCAATTTTGTCCAATGGAACTGTTTACTCAAGGGTTGGCACTGCATGTGTTGC
rJMSF033N01+ TTTGTCCAATGGAACTGTTTACTCAAGGGTTGGCACTGCATGTG-TGC
                      ____________________________________________________________
consensus TGCCGCATCAATTTTGTCCAATGGAACTGTTTACTCAAGGGTTGGCACTGCATGTGTTGC
 
. : . : . : . : . : . :
rJMSF037M06+ TATGGTTGCTCATCAATTCCGTGTTCCTGTCCTGATATGTTGTGAAGCATATAAATTTCA
rJMSF009N09+ TATGGTTGCTCATCAATTCCGTGTTCCTGTCCTGATATGTTGTGAAGCATATAAATTTCA
rJMFF026C16+ ATGGTTGCTCATCAATTCCGTGTTCCTGTCCTGATATGTNGTGAAGCATATAAATTTCA
rJMSF033N01+ TATGGTTGCTCATCAATTCCGTGTTCCTGTCCTGATATGTTGTGAAGCATATAAATTTCA
                      ____________________________________________________________
consensus TATGGTTGCTCATCAATTCCGTGTTCCTGTCCTGATATGTTGTGAAGCATATAAATTTCA
 
. : . : . : . : . : . :
rJMSF037M06+ TGAAAGGGTTCAACTTGACTCAATTTGTTCTAATGAACTTGGTGATCCAGAAGCAATTGC
rJMSF009N09+ TGAAAGGGTTCAACTTGACTCAATTTGTTCTAATGAACTTGGTGATCCAGAAGCAATTGC
rJMFF026C16+ TGAAAGGGTTCAACTTGACTCAATTTGTTCTAATGAACTTGGTGATCCAGAAGCAATTGC
rJMSF033N01+ TGAAAGGGTTCAACTTGACTCAATTTGTTCTAATGAACTTGGTGATCCAGAAGCAATTGC
                      ____________________________________________________________
consensus TGAAAGGGTTCAACTTGACTCAATTTGTTCTAATGAACTTGGTGATCCAGAAGCAATTGC
 
. : . : . : . : . : . :
rJMSF037M06+ AAATGTTCCTGGTGGTAAGGCAGTCAAACATTTGGATAATTGGTCTAGTAGTGAAAATCT
rJMSF009N09+ AAATGTTCCTGGTGGTAAGGCAGTCAAACATTTGGATAATTGGTCTAGTAGTGAAAATCT
rJMFF026C16+ AAATGTTCCTGGTGGTAAGGCAGTCAAACATTTGGATAATTGGTCTAGTAGTGAAAATCT
rJMSF033N01+ AAATGTTCCTGGTGGTAAGGCAGTCAAACATTTGGATAATTGGTCTAGTAGTGAAAATCT
                      ____________________________________________________________
consensus AAATGTTCCTGGTGGTAAGGCAGTCAAACATTTGGATAATTGGTCTAGTAGTGAAAATCT
 
. : . : . : . : . : . :
rJMSF037M06+ ACAACTTCTGAATCTGATTTATGATGCAACACCAGCGGATTATGTGTCAATGATAATCAC
rJMSF009N09+ ACAACTTCTGAATCTGATTTATGATGCAACACCAGCGGATTATGTGTCAATGATAATCAC
rJMFF026C16+ NCAACTTCNGAATNTGATTTATGATGCAACACCAGCGGATTATGTGTCAATGATAATCAC
rJMSF033N01+ ACAACTTCTGAATCTGATTTATGATGCAACACCAGCGGATTATGTGTCAATGATAATCAC
                      ____________________________________________________________
consensus ACAACTTCTGAATCTGATTTATGATGCAACACCAGCGGATTATGTGTCAATGATAATCAC
 
. : . : . : . : . : . :
rJMSF037M06+ AGATTATGGAATGATTCCTCCAACAAGTGTTCCTGTCATTGTTCGAGAATACCGCAGAGA
rJMSF009N09+ AGATTATGGAATGATTCCTCCAACAAGTGTTCCTGTCATTGTTCGAGAATACCGCAGAGA
rJMFF026C16+ AGATTATGGAATGATTCCTCCAACAAGTGTTCCTGTCATTGTTCGAGAATACCGCAGAGA
rJMSF033N01+ AGATTATGGAATGATTCCTCCAACAAGTGTTCCTGTCATTGTTCGAGAATACCGCAGAGA
                      ____________________________________________________________
consensus AGATTATGGAATGATTCCTCCAACAAGTGTTCCTGTCATTGTTCGAGAATACCGCAGAGA
 
. : . : . : . : . : . :
rJMSF037M06+ ACACTTGTGGACTTAGAGGGCACCAGGAAATGTCAGAGCTTCAAGGGTTAATACAGGAGC
rJMSF009N09+ ACACTTGTGGACTTAGAGGGCACCAGGAAATGTCAGAGCTTCAAGGGTTAATACAGGAGC
rJMFF026C16+ ACNCTTGTGGACTTAGAGGGCACCAGGAAATGTCAGAGCTTCAAGGGTTAATACAGGAGC
rJMSF033N01+ ACACTTGTGGACTTAGAGGGCACCAGGAAATGTCAGAGCTTCAAGGGTTAATACAGGAGC
                      ____________________________________________________________
consensus ACACTTGTGGACTTAGAGGGCACCAGGAAATGTCAGAGCTTCAAGGGTTAATACAGGAGC
 
. : . : . : . : . : . :
rJMSF037M06+ GATTTTGATCTCAGCCCGGTGTCAATTGCTGTTGGAGTCCCCTATCTTGCTGAGGAAGCA
rJMSF009N09+ GATTTTGATCTCAGCCCGGTGTCAATTGCTGTTGGAGTCCCCTATCTTGCTGAGGAAGCA
rJMFF026C16+ GATTTNGATCTCAGCCCGGTGTCAATTGCTGTTGGAGTCCCCTATCTTGCTGAGGAAGCA
rJMSF033N01+ GATTTTGATCTCAGCCCGGTGTCAATTGCTGTTGGAGTCCCCTATCTTGCTGAGGAAGCA
                      ____________________________________________________________
consensus GATTTTGATCTCAGCCCGGTGTCAATTGCTGTTGGAGTCCCCTATCTTGCTGAGGAAGCA
 
. : . : . : . : . : . :
rJMSF037M06+ ATTTGAGGCATCTGCTGTGAACACTAAAATTTCTTTTGCATCCGTAGTTTAATTCTTGGT
rJMSF009N09+ ATTTGAGGCATCTGCTGTGAACACTAAAATTTCTTTTGCATCCGTAGTTTAATTCTTGGT
rJMFF026C16+ ATTTGAGGCATCTGCTGTGAACANTAAAATTTCTTTTGCATCCGTAGTTTAATTCTNGGT
rJMSF033N01+ ATTTGAGGCATCTGCTGTGAACACTAAAATTTCTTTTGCATCCGTAGTTTAATTCTTGGT
                      ____________________________________________________________
consensus ATTTGAGGCATCTGCTGTGAACACTAAAATTTCTTTTGCATCCGTAGTTTAATTCTTGGT
 
. : . : . : . : . : . :
rJMSF037M06+ TCTCGTGGAATAATAATTTGTCTTGTGATGTACTCGAGATTTTGGATTTCCCATTTTTAC
rJMSF009N09+ TCTCGTGGAATAATAATTTGTCTTGTGATGTACTCGAGATTTTGGATTTCCCATTTTTAC
rJMFF026C16+ TCTCGTGGAATAATAATTTGTCTTGNGATGTACTCGAGATTTTNGATNTCCCANNTTTAC
rJMSF033N01+ TCTCGTGGAATAATAATTTGTCTTGTGATGTACTCGAGATTTTGGATTTCCCATTTTTAC
                      ____________________________________________________________
consensus TCTCGTGGAATAATAATTTGTCTTGTGATGTACTCGAGATTTTGGATTTCCCATTTTTAC
 
. : . : . : . : . : . :
rJMSF037M06+ ATGACCCCGTGAAGAGAGCGATTGGTCCGCCTCTCCAGGGTAGAG
rJMSF009N09+ ATGACCCCGTGAAGAGAGCGATTGGTCCGCCTCT-CAGGGTAGAG
rJMFF026C16+ ATGACCCCGTGAAGAGAGCGATTGGTCCGCCTCT-CAGGGTAGAG-TTCAGAAACACTNC
rJMSF033N01+ ATGACCCCGTGAAGAGAGCGATTGGTCCGCCTCT-CAGGGTAGAGTTTTTGAAACACTTC
                      ____________________________________________________________
consensus ATGACCCCGTGAAGAGAGCGATTGGTCCGCCTCT-CAGGGTAGAGTTTTTGAAACACTTC
 
. : . : . : . : . : . :
rJMFF026C16+ AATTTTCCTAAGAGGCTGTTA-TGGAAAACAT
rJMSF033N01+ AATTTTCTTAAGAGGCTGTTATTGGAAAACATCAATTTTGTTCTCATTCTTTCTCCCTGC
                      ____________________________________________________________
consensus AATTTTCTTAAGAGGCTGTTATTGGAAAACATCAATTTTGTTCTCATTCTTTCTCCCTGC