Previous Contig 012906:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033J18Sequence610019766gb:AB028022_15177864e-24Nicotiana tabacum wizz mRNA, complete cds.723012906 (2)gb:AB028022_15177868e-33Nicotiana tabacum wizz mRNA, complete cds.
JMSF034J18Sequence669019811sp|Q88AZ5|HSLO_PSESM2e-8333 kDa chaperonin (Heat shock protein 33 homolog) (HSP33).>gb:AE016856_349696 Ps464012906 (2)gb:AB028022_15177868e-09Nicotiana tabacum wizz mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033J18+ TCCT
                      ____________________________________________________________
consensus TCCT
 
. : . : . : . : . : . :
rJMSF033J18+ AGCTGCCCAGTCAAGAAGAAGGTGCAAAGAAGCGTAGAAGATCAGTCAATCTTGGTGGCA
                      ____________________________________________________________
consensus AGCTGCCCAGTCAAGAAGAAGGTGCAAAGAAGCGTAGAAGATCAGTCAATCTTGGTGGCA
 
. : . : . : . : . : . :
rJMSF033J18+ ACATATGAAGGAGAGCACAACCATGACCTCCCTTCAAAGCTAGAACAATCCCCCACCACT
                      ____________________________________________________________
consensus ACATATGAAGGAGAGCACAACCATGACCTCCCTTCAAAGCTAGAACAATCCCCCACCACT
 
. : . : . : . : . : . :
rJMSF033J18+ GCCACCGCAGCCGGCCGTTCTTTGCCGCCAGTCATCAATGGTGGCTCCGCCACAGCAGCT
                      ____________________________________________________________
consensus GCCACCGCAGCCGGCCGTTCTTTGCCGCCAGTCATCAATGGTGGCTCCGCCACAGCAGCT
 
. : . : . : . : . : . :
rJMSF034J18+ ACGCCGCCCAAAACAGCACCGTNTTCAGTG
rJMSF033J18+ GCCTCCCTCAACACCCAACCACGTGACCTAACGCCGCCCAAAACAGCACCGTCTTCAGTG
                      ____________________________________________________________
consensus GCCTCCCTCAACACCCAACCACGTGACCTAACGCCGCCCAAAACAGCACCGTCTTCAGTG
 
. : . : . : . : . : . :
rJMSF034J18+ GCCAATGCCAATGGTGGNTAAAACCGCCTCTACCCCGACGGCCGGAAGCTCANTACTGCC
rJMSF033J18+ GCCAATGCCAATGGT-GCTAAAACCGCCTCTACCCCGACGGCCGGAAGCTCATTACTGCC
                      ____________________________________________________________
consensus GCCAATGCCAATGGTGGCTAAAACCGCCTCTACCCCGACGGCCGGAAGCTCATTACTGCC
 
. : . : . : . : . : . :
rJMSF034J18+ GGTTGACAGGCCGGATTTTCAACAGNTCTTTNTTGAACAAATGGCATCTTCNTTAACAAA
rJMSF033J18+ GGTTGACAGGCCGGATTTTCAACAGTTCTTTATTGAACAAATGGCATCTTCCTTAACAAA
                      ____________________________________________________________
consensus GGTTGACAGGCCGGATTTTCAACAGTTCTTTATTGAACAAATGGCATCTTCCTTAACAAA
 
. : . : . : . : . : . :
rJMSF034J18+ AGATNCCACCTTCAGAGCAGCCATCGCAGCCGCCATTTCAGGAAAATTCCCCTCACATNN
rJMSF033J18+ AGATCCCACCTTCAAAGCAGCCATCGCAGCCGCCATTTCAGGAAAATTCCCCTCACATAA
                      ____________________________________________________________
consensus AGATCCCACCTTCAGAGCAGCCATCGCAGCCGCCATTTCAGGAAAATTCCCCTCACATAA
 
. : . : . : . : . : . :
rJMSF034J18+ CAACAGAGAGAAATGGTAAAATATTAAAGCTTGTTTACTTGTTTGGTCCGTTCATAACNG
rJMSF033J18+ CAACAGAGAGAAATGGTAAAATATTAAAGCTTGTTTACTTGTTTGGTCCGTTCATAACAC
                      ____________________________________________________________
consensus CAACAGAGAGAAATGGTAAAATATTAAAGCTTGTTTACTTGTTTGGTCCGTTCATAACAG
 
. : . : . : . : . : . :
rJMSF034J18+ GATGTCAAGAAAATACCATAAGTTTGTTCACTAAAAGTGACCAAAATTTGATATTTTATA
rJMSF033J18+ GATGTCAAGAAAATACCATAAGTTTGTTCACTAAAAGTGACCAAAATTTGATATTTTATA
                      ____________________________________________________________
consensus GATGTCAAGAAAATACCATAAGTTTGTTCACTAAAAGTGACCAAAATTTGATATTTTATA
 
. : . : . : . : . : . :
rJMSF034J18+ TGACATGGTGTTANTAATTCAGTACACATCTTTGAGTAATGGTCGCGGTAGTTNCCCTGT
rJMSF033J18+ TGACATGGTGTTATTAATTCAGTACACATCTTTGAGTAATGGTCGCGGTAGTTACCCTGT
                      ____________________________________________________________
consensus TGACATGGTGTTATTAATTCAGTACACATCTTTGAGTAATGGTCGCGGTAGTTACCCTGT
 
. : . : . : . : . : . :
rJMSF034J18+ TTGTAGTTTGGATAAGCGGAATTTGTAAATACCAATATTCAAAAGGGGGTCCACAATGGC
rJMSF033J18+ TTGTAGTTTGGATAAGCGGAATTTGTAAATACCAATATTCAAAAGGGGGTCCACAATGGC
                      ____________________________________________________________
consensus TTGTAGTTTGGATAAGCGGAATTTGTAAATACCAATATTCAAAAGGGGGTCCACAATGGC
 
. : . : . : . : . : . :
rJMSF034J18+ GCTGANCCCGGTCC
rJMSF033J18+ GCTGAACCCGGTCCATGGGCCACTCTAGAGTTCGAAAGTTCAAGAGCTGAATGCTCCTTT
                      ____________________________________________________________
consensus GCTGAACCCGGTCCATGGGCCACTCTAGAGTTCGAAAGTTCAAGAGCTGAATGCTCCTTT