Previous Contig 012903:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021C22Sequence722006884 (3)gb:AF503433_18067282e-61Sorghum bicolor BAC 170F8, complete sequence.778012903 (3)gb:AY013245_15584812e-87Oryza sativa (japonica cultivar-group) chromosome 3 BAC 36I5, partial sequence.>
JMSF033I09Sequence687006884 (3)gb:AY078410_15680782e-64Arabidopsis thaliana transporter associated with antigen processing-like protein726012903 (3)gb:AY013245_15584817e-85Oryza sativa (japonica cultivar-group) chromosome 3 BAC 36I5, partial sequence.>
JMSF043C05Sequence780006884 (3)gb:AY078410_15680782e-73Arabidopsis thaliana transporter associated with antigen processing-like protein695012903 (3)gb:AY013245_15584811e-95Oryza sativa (japonica cultivar-group) chromosome 3 BAC 36I5, partial sequence.>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043C05+ GGTCCAAGTGGAGGCGGAAAAAACAACCA
                      ____________________________________________________________
consensus GGTCCAAGTGGAGGCGGAAAAAACAACCA
 
. : . : . : . : . : . :
rJMSF043C05+ TTGCCAACTTGATTGAGAGGTTCTATGACCCGTTAAAGGGACAAATATTGCTTAATGGCG
rJMSF021C22+ TGCCAACTTGATTGAGAGGTTCTATGACCCGNTAAAGGGACAAATATTGCTTAATGGCG
rJMSF033I09+ ATTGCTTAATGGCG
                      ____________________________________________________________
consensus TTGCCAACTTGATTGAGAGGTTCTATGACCCGTTAAAGGGACAAATATTGCTTAATGGCG
 
. : . : . : . : . : . :
rJMSF043C05+ TTCCTTTGATGGAAATATCACATGAATATTTACACAGCAAGATTAGTATAGTAAGCCAGG
rJMSF021C22+ TTCCTTTGATGGAAATATCACATGAATATTTACACAGCAAGATTAGTATAGTAAGCCAGG
rJMSF033I09+ TTCCTTTGATGGAAATATCACATGAATATTTACACAGCAAGATTAGTATAGTAAGCCAGG
                      ____________________________________________________________
consensus TTCCTTTGATGGAAATATCACATGAATATTTACACAGCAAGATTAGTATAGTAAGCCAGG
 
. : . : . : . : . : . :
rJMSF043C05+ AGCCTGTTCTTTTCAACTGTTCCATTCAAGAGAACATTGCATATGGTTTTGAAGGCAGCA
rJMSF021C22+ AGCCTGTTCTTTTCAACTGTTCCATTCAAGAGAACATTGCATATGGTTTTGAAGGCAGCA
rJMSF033I09+ AGCCTGTTCTTTTCAACTGTTCCATTCAAGAGAACATTGCATATGGTTTTGAAGGCAGCA
                      ____________________________________________________________
consensus AGCCTGTTCTTTTCAACTGTTCCATTCAAGAGAACATTGCATATGGTTTTGAAGGCAGCA
 
. : . : . : . : . : . :
rJMSF043C05+ CCAGCAGTGATGTCGTAGAAAATGCAGCA--------AAAATGGCGAACGCTCATGATTT
rJMSF021C22+ CCAGCAGTGATGTCGTAGAAAATGCAGCATGCTGCAGAAAATGGCGAACGCTCATGATTT
rJMSF033I09+ CCAGCAGTGATGTCGTAGAAAATGCAGCA--------AAAATGGCGAACGCTCATGATTT
                      ____________________________________________________________
consensus CCAGCAGTGATGTCGTAGAAAATGCAGCA--------AAAATGGCGAACGCTCATGATTT
 
. : . : . : . : . : . :
rJMSF043C05+ CATTGAATCGTTTCCTGATAAATATCAAACTGTTGTTGGAGAACGCGGACTCAGGCTATC
rJMSF021C22+ CATTGAATCGTTTCCTGATAAATATCAAACTGTTGTTGGAGAACGCGGACTCAGGCTATC
rJMSF033I09+ CATTGAATCGTTTCCTGATAAATATCAAACTGTTGTTGGAGAACGCGGACTCAGGCTATC
                      ____________________________________________________________
consensus CATTGAATCGTTTCCTGATAAATATCAAACTGTTGTTGGAGAACGCGGACTCAGGCTATC
 
. : . : . : . : . : . :
rJMSF043C05+ AGGAGGCCAGAAGCAACGAATAGCAATCGCTAGGGCTCTTTTGATGAATCCTAGAGTCCT
rJMSF021C22+ AGGAGGCCAGAAGCAACGAATAGCAATCGCTAGGGCTCTTTTGATGAATCCTAGAGTCCT
rJMSF033I09+ AGGAGGCCAGAAGCAACGAATAGCAATCGCTAGGGCTCTTTTGATGAATCCTAGAGTCCT
                      ____________________________________________________________
consensus AGGAGGCCAGAAGCAACGAATAGCAATCGCTAGGGCTCTTTTGATGAATCCTAGAGTCCT
 
. : . : . : . : . : . :
rJMSF043C05+ GCTATTGGATGAAGCTACTAGCGCTCTAGACGCCGAGAGTGAATACCTAGTACAAGACGC
rJMSF021C22+ GCTATTGGATGAAGCTACTAGCGCTCTAGACGCCGAGAGTGAATACCTAGTACAAGACGC
rJMSF033I09+ GCTATTGGATGAAGCTACTAGCGCTCTAGACGCCGAGAGTGAATACCTAGTACAAGACGC
                      ____________________________________________________________
consensus GCTATTGGATGAAGCTACTAGCGCTCTAGACGCCGAGAGTGAATACCTAGTACAAGACGC
 
. : . : . : . : . : . :
rJMSF043C05+ CATGGATTCTCTGATGAGAGGCAGGACAGTTCTTGTAATCGCCCACCGGCTATCAACCGT
rJMSF021C22+ CATGGATTCTCTGATGAGAGGCAGGACAGTTCTTGTAATCGCCCACCGGCTATCAACCGT
rJMSF033I09+ CATGGATTCTCTGATGAGAGGCAGGACAGTTCTTGTAATCGCCCACCGGCTATCAACCGT
                      ____________________________________________________________
consensus CATGGATTCTCTGATGAGAGGCAGGACAGTTCTTGTAATCGCCCACCGGCTATCAACCGT
 
. : . : . : . : . : . :
rJMSF043C05+ AAAAACTGCAGACACAGTTGCAGTGGTGTCTGATGGACAGATAGTAGAGAGTGGGACGCA
rJMSF021C22+ AAAAACTGCAGACACAGTTGCAGTGGTGTCTGATGGACAGATAGTAGAGAGTGGGACGCA
rJMSF033I09+ AAAAACTGCAGACACAGTTGCAGTGGTGTCTGATGGACAGATAGTAGAGAGTGGGACGCA
                      ____________________________________________________________
consensus AAAAACTGCAGACACAGTTGCAGTGGTGTCTGATGGACAGATAGTAGAGAGTGGGACGCA
 
. : . : . : . : . : . :
rJMSF043C05+ CAATGAACTTCTTGCCAAGGATGGCATTTACACTGCACTGGTCAGGAGGCAATTGCAGGC
rJMSF021C22+ CAATGAACTTCTTGCCAAGGATGGCATTTACACTGCACTGGTCAGGAGGCAATTGCAGGC
rJMSF033I09+ CAATGAACTTCTTGCCAAGGATGGCATTTACACTGCACTGGTCAGGAGGCAATTGCAGGC
                      ____________________________________________________________
consensus CAATGAACTTCTTGCCAAGGATGGCATTTACACTGCACTGGTCAGGAGGCAATTGCAGGC
 
. : . : . : . : . : . :
rJMSF043C05+ ACCAAGAAATGAACTCTAAGATCAGTCACTTGAGTGGTTTGTTATTTGCTTTATCTATTC
rJMSF021C22+ ACCAAGAAATGAACTCTAAGATCAGTCACTTGAGTGGTTTGTTATTTGCTTTATCTATTC
rJMSF033I09+ ACCAAGAAATGAACTCTAAGATCAGTCACTTGAGTGGTTTGTTATTTGCTTTATCTATTC
                      ____________________________________________________________
consensus ACCAAGAAATGAACTCTAAGATCAGTCACTTGAGTGGTTTGTTATTTGCTTTATCTATTC
 
. : . : . : . : . : . :
rJMSF043C05+ TAAAACTTTCATTT
rJMSF021C22+ TAAAACTTTCATTTTGCTTGTGAGAATTGAAGGCTAACCAGATAAAATGTTGTTAGACAG
rJMSF033I09+ TAAAACTTTCATTTTGCTTGTGAGAATTGAAGGCTAACCAGATAAAATGTTGTTAGACAG
                      ____________________________________________________________
consensus TAAAACTTTCATTTTGCTTGTGAGAATTGAAGGCTAACCAGATAAAATGTTGTTAGACAG
 
. : . : . : . : . : . :
rJMSF021C22+ AGCTTATGACTTATAGATTATGATTATGGATGGAGTTAACAATAAATTTAACTATTTTT
rJMSF033I09+ AGCTTATGACTTATAGATTATGATTATGGATGGAGTTAACAATAAATTTAACTATTTTTG
                      ____________________________________________________________
consensus AGCTTATGACTTATAGATTATGATTATGGATGGAGTTAACAATAAATTTAACTATTTTTG