Previous Contig 012899:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036A02Sequence534006880 (2)gb:AF006079_17608522e-58Solanum berthaultii glucose acyltransferase (pldp15) mRNA, complete cds.787012899 (2)gb:AF248647_17806663e-71Lycopersicon pennellii glucose acyltransferase (AT) mRNA, complete cds.
JMSF033H09Sequence663006880 (2)gb:AF248647_17806661e-67Lycopersicon pennellii glucose acyltransferase (AT) mRNA, complete cds.766012899 (2)gb:AF248647_17806662e-71Lycopersicon pennellii glucose acyltransferase (AT) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF036A02+ CGAATGGGGCTTTTATCAGACAAT
                      ____________________________________________________________
consensus CGAATGGGGCTTTTATCAGACAAT
 
. : . : . : . : . : . :
rJMFF036A02+ CTGTACAAGTCCACAAAAGTAAGTTGCGATGGGCATTACATAGATGAACATCCGCAAAGG
rJMSF033H09+ CAAAAGTAAGNTGCGATGGNCATTACATAGATGAACATCCGCAAA-G
                      ____________________________________________________________
consensus CTGTACAAGTCCACAAAAGTAAGTTGCGATGGGCATTACATAGATGAACATCCGCAAAGG
 
. : . : . : . : . : . :
rJMFF036A02+ TGCAGCATGTCAATATGATCTTGAAAGAGTATCAAAGTGTACTGAAAAGGTTAACGAGGA
rJMSF033H09+ TGCAGCATGTCAATATGATCTTGAAAGAGTATCAAAGTGTACTGAAAAGGTTAACGAGGA
                      ____________________________________________________________
consensus TGCAGCATGTCAATATGATCTTGAAAGAGTATCAAAGTGTACTGAAAAGGTTAACGAGGA
 
. : . : . : . : . : . :
rJMFF036A02+ GCAAATTTTAGAACCAAATTGTAGCAATAAAAATTTACTGAGTCTAGATGTGAGCTCTAT
rJMSF033H09+ GCAAATTTTAGAACCAAAGTGTAGCAATAAAAATTTACTGAGTCTAGATGTGAGCTCTAT
                      ____________________________________________________________
consensus GCAAATTTTAGAACCAAATTGTAGCAATAAAAATTTACTGAGTCTAGATGTGAGCTCTAT
 
. : . : . : . : . : . :
rJMFF036A02+ TGGTGAAAATGTTACCAGTCTCCTTTTATTGCAACACTGGTGCAGAGACGATAATTATTT
rJMSF033H09+ TGGTGAAAATGTTACCAGTCTCCTTTTATTGCAACACTGGTGCAGAGACGATAATTATTT
                      ____________________________________________________________
consensus TGGTGAAAATGTTACCAGTCTCCTTTTATTGCAACACTGGTGCAGAGACGATAATTATTT
 
. : . : . : . : . : . :
rJMFF036A02+ GTACTCTTCCATTTGGGCAAATAACAAAATTGCCCAGAAAGCACTTCACGTGCGTGAGGA
rJMSF033H09+ GTACTCTTCCATTTGGGCAAATAACAAAATTGCCCAGAAAGCACTTCACGTGCGTGAGGA
                      ____________________________________________________________
consensus GTACTCTTCCATTTGGGCAAATAACAAAATTGCCCAGAAAGCACTTCACGTGCGTGAGGA
 
. : . : . : . : . : . :
rJMFF036A02+ ATCAATAACAGAGTGGGTCAGATGCGAGGAGAGGACTGAAGCATACATTTATGATGTCAA
rJMSF033H09+ ATCAATAACAGAGTGGGTCAGATGCGAGGAGAGGACTGAAGCATACATTTATGATGTCAA
                      ____________________________________________________________
consensus ATCAATAACAGAGTGGGTCAGATGCGAGGAGAGGACTGAAGCATACATTTATGATGTCAA
 
. : . : . : . : . : . :
rJMFF036A02+ AAGCACAGTCGATTATCATAAGAGTTTCACCAACAAATCTTGTCGTGCTCTAATCTACAG
rJMSF033H09+ AAGCACAGTCGATTATCATAAGAGTTTCACCAACAAATCTTGTCGTGCTCTAATCTACAG
                      ____________________________________________________________
consensus AAGCACAGTCGATTATCATAAGAGTTTCACCAACAAATCTTGTCGTGCTCTAATCTACAG
 
. : . : . : . : . : . :
rJMFF036A02+ TGGGGATCATGACATGGTTATTCCTCATTTGAGCACAGAAGAATGGATAGAGTCCTTAAA
rJMSF033H09+ TGGGGATCATGACATGGTTATTCCTCATTTGAGCACAGAAGAATGGATAGAGTCCTTAAA
                      ____________________________________________________________
consensus TGGGGATCATGACATGGTTATTCCTCATTTGAGCACAGAAGAATGGATAGAGTCCTTAAA
 
. : . : . : . : . : . :
rJMFF036A02+ CTTTGTGGTTGAAGACGAGTGGAGACCTTGGTTTGTTGAAGATCAAGTTGCAGGATACAC
rJMSF033H09+ CTTTGTGGTTGAAGACGAGTGGAGACCTTGGTTTGTTGAAGATCAAGTTGCAGGATACAC
                      ____________________________________________________________
consensus CTTTGTGGTTGAAGACGAGTGGAGACCTTGGTTTGTTGAAGATCAAGTTGCAGGATACAC
 
. : . : . : . : . : . :
rJMFF036A02+ CATGAAGTATTTAGAGAAGGAGTATGAGTTGACATATGCAACTGTAAAGGGAGCAGGTCA
rJMSF033H09+ CATGAAGTATTTAGAGAAGGAGTATGAGTTGACATATGCAACTGTAAAGGGAGCAGGTCA
                      ____________________________________________________________
consensus CATGAAGTATTTAGAGAAGGAGTATGAGTTGACATATGCAACTGTAAAGGGAGCAGGTCA
 
. : . : . : . : . : . :
rJMFF036A02+ TACAGCACCAGAGTATAAGCCACAACAATGCTTGGCAATGCTTCAGAGATGGCTTAGCAA
rJMSF033H09+ TACAGCACCAGAGTATAAGCCACAACAATGCTTGGCAATGCTTCAGAGATGGCTTAGCAA
                      ____________________________________________________________
consensus TACAGCACCAGAGTATAAGCCACAACAATGCTTGGCAATGCTTCAGAGATGGCTTAGCAA
 
. : . : . : . : . : . :
rJMFF036A02+ TTATTCTCTTTGATTATGTAAT
rJMSF033H09+ TTATTCTCTTTGATTATGTAATTGGATGCATATTCCATAAATAAAATAGCAAGGGATTGA
                      ____________________________________________________________
consensus TTATTCTCTTTGATTATGTAATTGGATGCATATTCCATAAATAAAATAGCAAGGGATTGA
 
. : . : . : . : . : . :
rJMSF033H09+ TTTAATGCTAATGTGATGATTTTTATATGGTGTAATAAGAATTTATGAATGTATAGGTAT
                      ____________________________________________________________
consensus TTTAATGCTAATGTGATGATTTTTATATGGTGTAATAAGAATTTATGAATGTATAGGTAT