Previous Contig 012898:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033H04Sequence659019758pir|T04465|T044650.004hypothetical protein F4D11.190 - Arabidopsis thaliana>gb:ATCHRIV77_1547181 Arabi748012898 (2)
JMSF038G20Sequence683019978gb:AY084947_15700291e-09Arabidopsis thaliana clone 12261 mRNA, complete sequence.332012898 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033H04+ TCAGAGAATTACTCAGTAGAGGAGCTGGAAG
                      ____________________________________________________________
consensus TCAGAGAATTACTCAGTAGAGGAGCTGGAAG
 
. : . : . : . : . : . :
rJMSF033H04+ AATTTTGATTGCGACTGCTTACAAGCAAAGTGACTTAACATTGCCGTATTATGATTTATA
                      ____________________________________________________________
consensus AATTTTGATTGCGACTGCTTACAAGCAAAGTGACTTAACATTGCCGTATTATGATTTATA
 
. : . : . : . : . : . :
rJMSF033H04+ TTTTGACTTTGAATGAACATCCTGTTTGAAATTTCAGATGCTGCACAAGAGAAGAAAGAC
                      ____________________________________________________________
consensus TTTTGACTTTGAATGAACATCCTGTTTGAAATTTCAGATGCTGCACAAGAGAAGAAAGAC
 
. : . : . : . : . : . :
rJMSF033H04+ GGGCAACAAGATGGTGAGTTGGAAAAGAAGGATGGTGGAGCTGCAGAGTCTAAAAGTGCA
                      ____________________________________________________________
consensus GGGCAACAAGATGGTGAGTTGGAAAAGAAGGATGGTGGAGCTGCAGAGTCTAAAAGTGCA
 
. : . : . : . : . : . :
rJMSF033H04+ AAGAAGAAGAAAAAGAAGGATAAATCTTTGAAGGAGGTGAAGGAATCACAAGACCAGCCT
                      ____________________________________________________________
consensus AAGAAGAAGAAAAAGAAGGATAAATCTTTGAAGGAGGTGAAGGAATCACAAGACCAGCCT
 
. : . : . : . : . : . :
rJMSF038G20+ CTGANCAAGCAGAA
rJMSF033H04+ AATAACAGCTTAGATGCCCCTAATGCACCGGAGGACCATGCAGAGACTGAGCAAGCAGAA
                      ____________________________________________________________
consensus AATAACAGCTTAGATGCCCCTAATGCACCGGAGGACCATGCAGAGACTGAGCAAGCAGAA
 
. : . : . : . : . : . :
rJMSF038G20+ GAAGAATCTGNTGTAAACGTGAAAGAAAAACTTAAGAAGGTGGNTTCTGCAAAGAAGAAG
rJMSF033H04+ GAAGAATCTGCTGTAAACGTGAAAGAAAAACTTAAGAAGGTGGCTTCTGCAAAGAAGAAG
                      ____________________________________________________________
consensus GAAGAATCTGCTGTAAACGTGAAAGAAAAACTTAAGAAGGTGGCTTCTGCAAAGAAGAAG
 
. : . : . : . : . : . :
rJMSF038G20+ AAATCTNGTAAAGATGCGGATGCAGCTGCTAAAGCTGCTGCCATGGAGGCAGCTGCAAGG
rJMSF033H04+ AAATCTAGTAAAGATACGGATGCAGCTGCTAAAGCTGCTGCCATGGAGGCAGCTGCAAGG
                      ____________________________________________________________
consensus AAATCTAGTAAAGATGCGGATGCAGCTGCTAAAGCTGCTGCCATGGAGGCAGCTGCAAGG
 
. : . : . : . : . : . :
rJMSF038G20+ AATGCAAGACTTGCTGCAGCTAAGAAGAAAGNGAAGAGCCANTNCAACCAGCAGCCAACG
rJMSF033H04+ AATGCAAGACTTGCTGCAGCTAAGAAGAAAGAGAAGAGCCATTACAACCAGCAGCCAACG
                      ____________________________________________________________
consensus AATGCAAGACTTGCTGCAGCTAAGAAGAAAGAGAAGAGCCATTACAACCAGCAGCCAACG
 
. : . : . : . : . : . :
rJMSF038G20+ AGGTAAACTGTAACCCATAACCAGCAGCCATCTGATGAAATCCAATTCTCTGGGTACTAC
rJMSF033H04+ AGGTAAACTGTAACCCATAACCAGCAGCCA-CTGATGAAATCCAATTCTCTGGGTACTAC
                      ____________________________________________________________
consensus AGGTAAACTGTAACCCATAACCAGCAGCCATCTGATGAAATCCAATTCTCTGGGTACTAC
 
. : . : . : . : . : . :
rJMSF038G20+ TGTCTGTAGAGGNTTGGTAATATCTTCATTGTTCACNTTTGCGNATGCGCAATNAGGTTC
rJMSF033H04+ TGTCTGTAGAGGATTGGTAATAT-TTCATTGTTCA-TTTTGCTGATGCGCAATAAGGTTT
                      ____________________________________________________________
consensus TGTCTGTAGAGGATTGGTAATATCTTCATTGTTCACTTTTGCTGATGCGCAATAAGGTTT
 
. : . : . : . : . : . :
rJMSF038G20+ GAGTGCAAGGCTCTGGT
rJMSF033H04+ GAGTGCAAGGCTCTGGTTTTTTGTCGACAGTCTAGATTAGGAGGTTAAAGTGTTTTGCTA
                      ____________________________________________________________
consensus GAGTGCAAGGCTCTGGTTTTTTGTCGACAGTCTAGATTAGGAGGTTAAAGTGTTTTGCTA
 
. : . : . : . : . : . :
rJMSF033H04+ GACAGTTTTGTTCAAACTTTAACCATTGTGGTACCTTGATGTGTATCATAGTAGCACTTC
                      ____________________________________________________________
consensus GACAGTTTTGTTCAAACTTTAACCATTGTGGTACCTTGATGTGTATCATAGTAGCACTTC